FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627008_at:

>probe:Drosophila_2:1627008_at:633:139; Interrogation_Position=14; Antisense; ACAGTCCTACGGCTCGAACATTTGG
>probe:Drosophila_2:1627008_at:697:165; Interrogation_Position=149; Antisense; AAATCGCAAGCAACAGTATCTAGGA
>probe:Drosophila_2:1627008_at:326:49; Interrogation_Position=186; Antisense; ATCCAATTCAATCCAGTAGGGACTG
>probe:Drosophila_2:1627008_at:230:549; Interrogation_Position=205; Antisense; GGACTGAAGTCATGGCGTTAAAGAT
>probe:Drosophila_2:1627008_at:96:663; Interrogation_Position=256; Antisense; TAAACTACGTGCAACAATATGTGGG
>probe:Drosophila_2:1627008_at:340:147; Interrogation_Position=325; Antisense; AAATGTCATCGGCAACCCTACGAGT
>probe:Drosophila_2:1627008_at:536:137; Interrogation_Position=344; Antisense; ACGAGTCCGTCGAGCTGTCGTCGAA
>probe:Drosophila_2:1627008_at:82:121; Interrogation_Position=356; Antisense; AGCTGTCGTCGAATCCTATCGCGGA
>probe:Drosophila_2:1627008_at:314:163; Interrogation_Position=385; Antisense; AAATTGCTCCCGATGATGCCATGCT
>probe:Drosophila_2:1627008_at:569:685; Interrogation_Position=40; Antisense; TATAGTTTAGTTTTCTCTGACCCGG
>probe:Drosophila_2:1627008_at:56:165; Interrogation_Position=437; Antisense; AAATATGTCTGAGATTCTGCACGAC
>probe:Drosophila_2:1627008_at:350:283; Interrogation_Position=453; Antisense; CTGCACGACCTTCAATTCAAGCTGA
>probe:Drosophila_2:1627008_at:244:565; Interrogation_Position=493; Antisense; GGAATCAAGTCATTCGTCTTCTGAA
>probe:Drosophila_2:1627008_at:356:279; Interrogation_Position=54; Antisense; CTCTGACCCGGTGAACGATAAGCAA

Paste this into a BLAST search page for me
ACAGTCCTACGGCTCGAACATTTGGAAATCGCAAGCAACAGTATCTAGGAATCCAATTCAATCCAGTAGGGACTGGGACTGAAGTCATGGCGTTAAAGATTAAACTACGTGCAACAATATGTGGGAAATGTCATCGGCAACCCTACGAGTACGAGTCCGTCGAGCTGTCGTCGAAAGCTGTCGTCGAATCCTATCGCGGAAAATTGCTCCCGATGATGCCATGCTTATAGTTTAGTTTTCTCTGACCCGGAAATATGTCTGAGATTCTGCACGACCTGCACGACCTTCAATTCAAGCTGAGGAATCAAGTCATTCGTCTTCTGAACTCTGACCCGGTGAACGATAAGCAA

Full Affymetrix probeset data:

Annotations for 1627008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720