FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627009_at:

>probe:Drosophila_2:1627009_at:620:201; Interrogation_Position=1000; Antisense; AACCGCATGTTGTTGGAGGCAGCCA
>probe:Drosophila_2:1627009_at:124:439; Interrogation_Position=1015; Antisense; GAGGCAGCCAAGTTCAAGTTTCTAA
>probe:Drosophila_2:1627009_at:306:45; Interrogation_Position=1040; Antisense; ATCCGAATTTTCAGTTTGAGCCGAA
>probe:Drosophila_2:1627009_at:356:677; Interrogation_Position=1094; Antisense; TAGACTCCGCGCCAGATTCTGAATC
>probe:Drosophila_2:1627009_at:371:593; Interrogation_Position=707; Antisense; TGGGTCGTCCTGTCAAGCCTGAGCA
>probe:Drosophila_2:1627009_at:205:419; Interrogation_Position=727; Antisense; GAGCAGGGTAGTGGTCCGTCATTCC
>probe:Drosophila_2:1627009_at:723:677; Interrogation_Position=773; Antisense; TAGATTTGAGCCAGGTTCCACCAGT
>probe:Drosophila_2:1627009_at:712:717; Interrogation_Position=788; Antisense; TTCCACCAGTGCAGGGCGAGAGTAA
>probe:Drosophila_2:1627009_at:31:167; Interrogation_Position=811; Antisense; AAATCCAGTGGATCGCTGGCTTCAT
>probe:Drosophila_2:1627009_at:379:287; Interrogation_Position=826; Antisense; CTGGCTTCATCGATGGAGGACGTCT
>probe:Drosophila_2:1627009_at:288:437; Interrogation_Position=841; Antisense; GAGGACGTCTCCATGGAGTACTCAC
>probe:Drosophila_2:1627009_at:612:149; Interrogation_Position=902; Antisense; ACTTCTTGGAGCATCCTCAGCGAGA
>probe:Drosophila_2:1627009_at:273:587; Interrogation_Position=941; Antisense; TGGAGCGCTCGATGGCCCAAATAAG
>probe:Drosophila_2:1627009_at:398:31; Interrogation_Position=961; Antisense; ATAAGTCAGGAGTTGCACTGCCGCA

Paste this into a BLAST search page for me
AACCGCATGTTGTTGGAGGCAGCCAGAGGCAGCCAAGTTCAAGTTTCTAAATCCGAATTTTCAGTTTGAGCCGAATAGACTCCGCGCCAGATTCTGAATCTGGGTCGTCCTGTCAAGCCTGAGCAGAGCAGGGTAGTGGTCCGTCATTCCTAGATTTGAGCCAGGTTCCACCAGTTTCCACCAGTGCAGGGCGAGAGTAAAAATCCAGTGGATCGCTGGCTTCATCTGGCTTCATCGATGGAGGACGTCTGAGGACGTCTCCATGGAGTACTCACACTTCTTGGAGCATCCTCAGCGAGATGGAGCGCTCGATGGCCCAAATAAGATAAGTCAGGAGTTGCACTGCCGCA

Full Affymetrix probeset data:

Annotations for 1627009_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720