Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627010_s_at:

>probe:Drosophila_2:1627010_s_at:695:527; Interrogation_Position=321; Antisense; GGGACATAGCCGCAAGGACAAGCAA
>probe:Drosophila_2:1627010_s_at:396:543; Interrogation_Position=347; Antisense; GGATCATCAATGTACGAATCGGTAA
>probe:Drosophila_2:1627010_s_at:439:489; Interrogation_Position=368; Antisense; GTAATCCGATCAAGCGGGAACTCGA
>probe:Drosophila_2:1627010_s_at:212:175; Interrogation_Position=450; Antisense; AAACCTTAGGGCTGGGTGATCACAA
>probe:Drosophila_2:1627010_s_at:120:455; Interrogation_Position=467; Antisense; GATCACAAATATCCCCATCACTATA
>probe:Drosophila_2:1627010_s_at:30:693; Interrogation_Position=495; Antisense; TTTGATCTTGTCTTGTGCGATGCAA
>probe:Drosophila_2:1627010_s_at:94:205; Interrogation_Position=629; Antisense; AAGCCACTTCTATAAGATCGCATTG
>probe:Drosophila_2:1627010_s_at:674:43; Interrogation_Position=645; Antisense; ATCGCATTGCGGGAAGCACACAAAA
>probe:Drosophila_2:1627010_s_at:544:333; Interrogation_Position=710; Antisense; GCTGTGTATGCTACCTAATGCCATT
>probe:Drosophila_2:1627010_s_at:36:231; Interrogation_Position=736; Antisense; AATGTGGCAACCATCATCGGCCATT
>probe:Drosophila_2:1627010_s_at:552:223; Interrogation_Position=765; Antisense; AAGGACTCCCTTTGAGGGCTGAACA
>probe:Drosophila_2:1627010_s_at:209:613; Interrogation_Position=784; Antisense; TGAACAAAGGTTGGCTAGCGCACTT
>probe:Drosophila_2:1627010_s_at:470:339; Interrogation_Position=797; Antisense; GCTAGCGCACTTGAGGGCCAATTGA
>probe:Drosophila_2:1627010_s_at:423:33; Interrogation_Position=829; Antisense; ATAATTTGATGGTGTGCGCTCTCCT

Paste this into a BLAST search page for me
GGGACATAGCCGCAAGGACAAGCAAGGATCATCAATGTACGAATCGGTAAGTAATCCGATCAAGCGGGAACTCGAAAACCTTAGGGCTGGGTGATCACAAGATCACAAATATCCCCATCACTATATTTGATCTTGTCTTGTGCGATGCAAAAGCCACTTCTATAAGATCGCATTGATCGCATTGCGGGAAGCACACAAAAGCTGTGTATGCTACCTAATGCCATTAATGTGGCAACCATCATCGGCCATTAAGGACTCCCTTTGAGGGCTGAACATGAACAAAGGTTGGCTAGCGCACTTGCTAGCGCACTTGAGGGCCAATTGAATAATTTGATGGTGTGCGCTCTCCT

Full Affymetrix probeset data:

Annotations for 1627010_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime