Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627013_at:

>probe:Drosophila_2:1627013_at:330:693; Interrogation_Position=2880; Antisense; TTTGTTAGTTTTCGTGTGTGTGTCC
>probe:Drosophila_2:1627013_at:562:231; Interrogation_Position=2943; Antisense; AATGACTCGCTGTGGTTTTAAGTAG
>probe:Drosophila_2:1627013_at:414:627; Interrogation_Position=2988; Antisense; TGCCAGTTGGGCGTGTAGCTTGTAA
>probe:Drosophila_2:1627013_at:46:421; Interrogation_Position=3018; Antisense; GAGAACAAACCCAGCTATTCCTAGT
>probe:Drosophila_2:1627013_at:412:475; Interrogation_Position=3041; Antisense; GTTAGCAATTTCACGCTCCAGTTTG
>probe:Drosophila_2:1627013_at:196:337; Interrogation_Position=3055; Antisense; GCTCCAGTTTGCTATACGCGATACT
>probe:Drosophila_2:1627013_at:253:89; Interrogation_Position=3099; Antisense; AGTAATCATTTCTCCTAGCGTTAAA
>probe:Drosophila_2:1627013_at:416:707; Interrogation_Position=3164; Antisense; TTAAGCTACACCAACTTGTTTCCGC
>probe:Drosophila_2:1627013_at:511:727; Interrogation_Position=3179; Antisense; TTGTTTCCGCTTCAAGTGCAATGCA
>probe:Drosophila_2:1627013_at:62:361; Interrogation_Position=3201; Antisense; GCAAGTTGAGTTCAGTTTTTCCACT
>probe:Drosophila_2:1627013_at:625:477; Interrogation_Position=3215; Antisense; GTTTTTCCACTTTTATTCCATAGAT
>probe:Drosophila_2:1627013_at:87:645; Interrogation_Position=3239; Antisense; TCTATTGAAAATTCCTGTCGCTGGG
>probe:Drosophila_2:1627013_at:249:503; Interrogation_Position=3255; Antisense; GTCGCTGGGAATACTCCGGTGTTAT
>probe:Drosophila_2:1627013_at:590:41; Interrogation_Position=3390; Antisense; ATCGTATTTCATTCTACTGTTGCAT

Paste this into a BLAST search page for me
TTTGTTAGTTTTCGTGTGTGTGTCCAATGACTCGCTGTGGTTTTAAGTAGTGCCAGTTGGGCGTGTAGCTTGTAAGAGAACAAACCCAGCTATTCCTAGTGTTAGCAATTTCACGCTCCAGTTTGGCTCCAGTTTGCTATACGCGATACTAGTAATCATTTCTCCTAGCGTTAAATTAAGCTACACCAACTTGTTTCCGCTTGTTTCCGCTTCAAGTGCAATGCAGCAAGTTGAGTTCAGTTTTTCCACTGTTTTTCCACTTTTATTCCATAGATTCTATTGAAAATTCCTGTCGCTGGGGTCGCTGGGAATACTCCGGTGTTATATCGTATTTCATTCTACTGTTGCAT

Full Affymetrix probeset data:

Annotations for 1627013_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime