Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627014_a_at:

>probe:Drosophila_2:1627014_a_at:102:649; Interrogation_Position=421; Antisense; TCACCATCGGCAACGTTAAGTGCGT
>probe:Drosophila_2:1627014_a_at:500:197; Interrogation_Position=432; Antisense; AACGTTAAGTGCGTGCGCGTCTACA
>probe:Drosophila_2:1627014_a_at:99:321; Interrogation_Position=446; Antisense; GCGCGTCTACAAGGCCGTCTAAGAG
>probe:Drosophila_2:1627014_a_at:83:227; Interrogation_Position=456; Antisense; AAGGCCGTCTAAGAGACTGATCTAA
>probe:Drosophila_2:1627014_a_at:293:655; Interrogation_Position=486; Antisense; TAATATCCATACGACTACATGCATT
>probe:Drosophila_2:1627014_a_at:488:457; Interrogation_Position=523; Antisense; GATAGCCAATATTCTTGTTGACTAA
>probe:Drosophila_2:1627014_a_at:107:3; Interrogation_Position=539; Antisense; GTTGACTAACAGTGAACTAAACCAA
>probe:Drosophila_2:1627014_a_at:467:239; Interrogation_Position=563; Antisense; AATCAAATGGAACTGCACGCTCTGC
>probe:Drosophila_2:1627014_a_at:592:585; Interrogation_Position=570; Antisense; TGGAACTGCACGCTCTGCCCAATGT
>probe:Drosophila_2:1627014_a_at:454:473; Interrogation_Position=593; Antisense; GTTAATTTATAATCGCACCCGTACA
>probe:Drosophila_2:1627014_a_at:46:261; Interrogation_Position=616; Antisense; CACCCGCAGTCGGTGTATGTGGGAA
>probe:Drosophila_2:1627014_a_at:681:61; Interrogation_Position=632; Antisense; ATGTGGGAATACTCCTCGTACTCGG
>probe:Drosophila_2:1627014_a_at:129:555; Interrogation_Position=657; Antisense; GGACCAATTTCCGAATGCATTTGAA
>probe:Drosophila_2:1627014_a_at:40:371; Interrogation_Position=695; Antisense; GAAGTGCTTTTAAAACATTCCGACT

Paste this into a BLAST search page for me
TCACCATCGGCAACGTTAAGTGCGTAACGTTAAGTGCGTGCGCGTCTACAGCGCGTCTACAAGGCCGTCTAAGAGAAGGCCGTCTAAGAGACTGATCTAATAATATCCATACGACTACATGCATTGATAGCCAATATTCTTGTTGACTAAGTTGACTAACAGTGAACTAAACCAAAATCAAATGGAACTGCACGCTCTGCTGGAACTGCACGCTCTGCCCAATGTGTTAATTTATAATCGCACCCGTACACACCCGCAGTCGGTGTATGTGGGAAATGTGGGAATACTCCTCGTACTCGGGGACCAATTTCCGAATGCATTTGAAGAAGTGCTTTTAAAACATTCCGACT

Full Affymetrix probeset data:

Annotations for 1627014_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime