FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627015_at:

>probe:Drosophila_2:1627015_at:179:307; Interrogation_Position=1006; Antisense; CCTGCATTTTGTTTCTGTCTGTTAA
>probe:Drosophila_2:1627015_at:331:225; Interrogation_Position=475; Antisense; AAGGACCAAGGCCTCAATGTGCTCT
>probe:Drosophila_2:1627015_at:54:231; Interrogation_Position=490; Antisense; AATGTGCTCTTCAACAATGCCGGCA
>probe:Drosophila_2:1627015_at:709:25; Interrogation_Position=514; Antisense; ATAGCGCCCAAATCGGCCAGGATAA
>probe:Drosophila_2:1627015_at:350:455; Interrogation_Position=534; Antisense; GATAACGGCCGTTCGATCGCAGGAG
>probe:Drosophila_2:1627015_at:558:173; Interrogation_Position=640; Antisense; AAAGCGAACGAATCCCAGCCGATGG
>probe:Drosophila_2:1627015_at:119:577; Interrogation_Position=670; Antisense; GGCCGTGCCGCCATTATTAACATGT
>probe:Drosophila_2:1627015_at:329:689; Interrogation_Position=684; Antisense; TATTAACATGTCCTCGATCCTTGGC
>probe:Drosophila_2:1627015_at:281:41; Interrogation_Position=797; Antisense; ATCTGTATCCGCAACGCATCATGTG
>probe:Drosophila_2:1627015_at:6:641; Interrogation_Position=828; Antisense; TCTGCATCCTGGCTGGGTGAAAACC
>probe:Drosophila_2:1627015_at:715:387; Interrogation_Position=846; Antisense; GAAAACCGACATGGGTGGCTCCAGT
>probe:Drosophila_2:1627015_at:160:541; Interrogation_Position=946; Antisense; GGTTTTGTCAACTACGACGGCACTC
>probe:Drosophila_2:1627015_at:158:145; Interrogation_Position=967; Antisense; ACTCCGCTGGCCTGGTAAACGATGA
>probe:Drosophila_2:1627015_at:89:399; Interrogation_Position=990; Antisense; GACAGCGGTTAGTTTACCTGCATTT

Paste this into a BLAST search page for me
CCTGCATTTTGTTTCTGTCTGTTAAAAGGACCAAGGCCTCAATGTGCTCTAATGTGCTCTTCAACAATGCCGGCAATAGCGCCCAAATCGGCCAGGATAAGATAACGGCCGTTCGATCGCAGGAGAAAGCGAACGAATCCCAGCCGATGGGGCCGTGCCGCCATTATTAACATGTTATTAACATGTCCTCGATCCTTGGCATCTGTATCCGCAACGCATCATGTGTCTGCATCCTGGCTGGGTGAAAACCGAAAACCGACATGGGTGGCTCCAGTGGTTTTGTCAACTACGACGGCACTCACTCCGCTGGCCTGGTAAACGATGAGACAGCGGTTAGTTTACCTGCATTT

Full Affymetrix probeset data:

Annotations for 1627015_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720