FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627017_at:

>probe:Drosophila_2:1627017_at:289:41; Interrogation_Position=296; Antisense; ATCGAGACGACCATCGGCGGTAACG
>probe:Drosophila_2:1627017_at:66:587; Interrogation_Position=363; Antisense; TGGAGAACTGCCTGACGGTGCTCAC
>probe:Drosophila_2:1627017_at:166:553; Interrogation_Position=391; Antisense; GGAGCAGAAGCCCTACAAGTACATT
>probe:Drosophila_2:1627017_at:665:273; Interrogation_Position=412; Antisense; CATTGTGACCGCCATGATCATGCAA
>probe:Drosophila_2:1627017_at:412:183; Interrogation_Position=435; Antisense; AAAAGAACGGTGCTGGACTCCACAC
>probe:Drosophila_2:1627017_at:526:117; Interrogation_Position=464; Antisense; AGCTCCTGCTACTGGAACAACGACA
>probe:Drosophila_2:1627017_at:142:209; Interrogation_Position=521; Antisense; AAGACCATGTACTGCATCGTTTCGG
>probe:Drosophila_2:1627017_at:377:349; Interrogation_Position=578; Antisense; GCAGGACTGCCGGAATTCGCGATGA
>probe:Drosophila_2:1627017_at:304:119; Interrogation_Position=625; Antisense; ACTAACAAGATTGCCGTCGTACACC
>probe:Drosophila_2:1627017_at:119:273; Interrogation_Position=674; Antisense; CATACTTTTTTGATCGGCCATCCAT
>probe:Drosophila_2:1627017_at:251:315; Interrogation_Position=690; Antisense; GCCATCCATCCTGCTGTAATAACAA
>probe:Drosophila_2:1627017_at:138:723; Interrogation_Position=732; Antisense; TTGAAAACCTTGTCGTCACTTCCAA
>probe:Drosophila_2:1627017_at:56:191; Interrogation_Position=770; Antisense; AACTATTCCGTTGCCAGTGTACTCG
>probe:Drosophila_2:1627017_at:460:515; Interrogation_Position=786; Antisense; GTGTACTCGCCTAATGTTATTCTTG

Paste this into a BLAST search page for me
ATCGAGACGACCATCGGCGGTAACGTGGAGAACTGCCTGACGGTGCTCACGGAGCAGAAGCCCTACAAGTACATTCATTGTGACCGCCATGATCATGCAAAAAAGAACGGTGCTGGACTCCACACAGCTCCTGCTACTGGAACAACGACAAAGACCATGTACTGCATCGTTTCGGGCAGGACTGCCGGAATTCGCGATGAACTAACAAGATTGCCGTCGTACACCCATACTTTTTTGATCGGCCATCCATGCCATCCATCCTGCTGTAATAACAATTGAAAACCTTGTCGTCACTTCCAAAACTATTCCGTTGCCAGTGTACTCGGTGTACTCGCCTAATGTTATTCTTG

Full Affymetrix probeset data:

Annotations for 1627017_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720