Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627018_s_at:

>probe:Drosophila_2:1627018_s_at:86:103; Interrogation_Position=1003; Antisense; AGAGCTATCTGGAGTTCTCGCTGGC
>probe:Drosophila_2:1627018_s_at:458:635; Interrogation_Position=1029; Antisense; TCGCTCATCTTCTACACCATGAAGG
>probe:Drosophila_2:1627018_s_at:339:485; Interrogation_Position=1081; Antisense; GTATGACTGCCATGGACAACGCTTC
>probe:Drosophila_2:1627018_s_at:622:197; Interrogation_Position=1098; Antisense; AACGCTTCCAAGAACGCCGGTGAGA
>probe:Drosophila_2:1627018_s_at:303:497; Interrogation_Position=1167; Antisense; GTCATCACTCGCGAGCTGATTGAAA
>probe:Drosophila_2:1627018_s_at:643:261; Interrogation_Position=690; Antisense; CAGGACGAGGCCAACACTAAGGTGT
>probe:Drosophila_2:1627018_s_at:472:145; Interrogation_Position=705; Antisense; ACTAAGGTGTTCTGCGTGGGCGACA
>probe:Drosophila_2:1627018_s_at:222:489; Interrogation_Position=755; Antisense; GTACGGCAAGAACATCCTGATGGTG
>probe:Drosophila_2:1627018_s_at:628:585; Interrogation_Position=814; Antisense; TGGACGCCTCGAAGATTGCCAACGA
>probe:Drosophila_2:1627018_s_at:697:435; Interrogation_Position=837; Antisense; GAGGTTCTGCAGACCGGTTACGATT
>probe:Drosophila_2:1627018_s_at:75:567; Interrogation_Position=870; Antisense; GGCAAGATCGTGTACAACCGTTTCA
>probe:Drosophila_2:1627018_s_at:664:475; Interrogation_Position=889; Antisense; GTTTCAAGTCGGTGGTGTCCTACCA
>probe:Drosophila_2:1627018_s_at:580:37; Interrogation_Position=930; Antisense; ATCTTCAGCGGATCCACCGTGGAGA
>probe:Drosophila_2:1627018_s_at:574:87; Interrogation_Position=955; Antisense; AGTCGGAGAAGCTGGCCGTCTACGA

Paste this into a BLAST search page for me
AGAGCTATCTGGAGTTCTCGCTGGCTCGCTCATCTTCTACACCATGAAGGGTATGACTGCCATGGACAACGCTTCAACGCTTCCAAGAACGCCGGTGAGAGTCATCACTCGCGAGCTGATTGAAACAGGACGAGGCCAACACTAAGGTGTACTAAGGTGTTCTGCGTGGGCGACAGTACGGCAAGAACATCCTGATGGTGTGGACGCCTCGAAGATTGCCAACGAGAGGTTCTGCAGACCGGTTACGATTGGCAAGATCGTGTACAACCGTTTCAGTTTCAAGTCGGTGGTGTCCTACCAATCTTCAGCGGATCCACCGTGGAGAAGTCGGAGAAGCTGGCCGTCTACGA

Full Affymetrix probeset data:

Annotations for 1627018_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime