Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627019_s_at:

>probe:Drosophila_2:1627019_s_at:573:299; Interrogation_Position=119; Antisense; CGCGATCGATTTACTGCTATGAGTG
>probe:Drosophila_2:1627019_s_at:257:619; Interrogation_Position=133; Antisense; TGCTATGAGTGCGACTCCTGGACTG
>probe:Drosophila_2:1627019_s_at:655:631; Interrogation_Position=148; Antisense; TCCTGGACTGATGCCCGCTGCAAGG
>probe:Drosophila_2:1627019_s_at:69:547; Interrogation_Position=171; Antisense; GGATCCTTTCAACTATACAGCCCTG
>probe:Drosophila_2:1627019_s_at:596:517; Interrogation_Position=274; Antisense; GTGGTGCGACGCATGTGTACGTCAC
>probe:Drosophila_2:1627019_s_at:730:347; Interrogation_Position=284; Antisense; GCATGTGTACGTCACAGTTACAGAT
>probe:Drosophila_2:1627019_s_at:108:689; Interrogation_Position=314; Antisense; TATTCATGGTCGATCACGTGTGCAT
>probe:Drosophila_2:1627019_s_at:227:269; Interrogation_Position=350; Antisense; CAGGCAATGGACATATGTGCTTTTG
>probe:Drosophila_2:1627019_s_at:567:17; Interrogation_Position=404; Antisense; ATTTACACACTAATGGTTGCCAGCT
>probe:Drosophila_2:1627019_s_at:630:469; Interrogation_Position=419; Antisense; GTTGCCAGCTGCATCTCATACCCAT
>probe:Drosophila_2:1627019_s_at:41:29; Interrogation_Position=436; Antisense; ATACCCATCGCAGTGGCAGTATCTT
>probe:Drosophila_2:1627019_s_at:328:521; Interrogation_Position=448; Antisense; GTGGCAGTATCTTGGCTAATGGGTC
>probe:Drosophila_2:1627019_s_at:664:279; Interrogation_Position=463; Antisense; CTAATGGGTCAATTGCTCAGCAGAT
>probe:Drosophila_2:1627019_s_at:534:727; Interrogation_Position=63; Antisense; TTGGCAATTGGCTGTTGGTATTAAC

Paste this into a BLAST search page for me
CGCGATCGATTTACTGCTATGAGTGTGCTATGAGTGCGACTCCTGGACTGTCCTGGACTGATGCCCGCTGCAAGGGGATCCTTTCAACTATACAGCCCTGGTGGTGCGACGCATGTGTACGTCACGCATGTGTACGTCACAGTTACAGATTATTCATGGTCGATCACGTGTGCATCAGGCAATGGACATATGTGCTTTTGATTTACACACTAATGGTTGCCAGCTGTTGCCAGCTGCATCTCATACCCATATACCCATCGCAGTGGCAGTATCTTGTGGCAGTATCTTGGCTAATGGGTCCTAATGGGTCAATTGCTCAGCAGATTTGGCAATTGGCTGTTGGTATTAAC

Full Affymetrix probeset data:

Annotations for 1627019_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime