FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627020_at:

>probe:Drosophila_2:1627020_at:225:259; Interrogation_Position=101; Antisense; CACTTTCCTGGACTGCGTTGGTTAT
>probe:Drosophila_2:1627020_at:85:581; Interrogation_Position=127; Antisense; TGGCCAGGGTGGATGGCATCTCCAT
>probe:Drosophila_2:1627020_at:658:643; Interrogation_Position=161; Antisense; TCTCAATCCCGTGCCGGATGAAAAG
>probe:Drosophila_2:1627020_at:499:387; Interrogation_Position=180; Antisense; GAAAAGGACTATGTGTTCCTGCTGC
>probe:Drosophila_2:1627020_at:150:31; Interrogation_Position=243; Antisense; ATAATATCGCTCATTTCACCCAAGG
>probe:Drosophila_2:1627020_at:158:543; Interrogation_Position=266; Antisense; GGATCCCGCCCAGAAGATTATCAAG
>probe:Drosophila_2:1627020_at:666:309; Interrogation_Position=322; Antisense; CCACGCTGGGCTACAAGCACGAGAT
>probe:Drosophila_2:1627020_at:504:469; Interrogation_Position=348; Antisense; GTTCGCGTACCCGAAGGACATTGTT
>probe:Drosophila_2:1627020_at:122:127; Interrogation_Position=36; Antisense; ACCAGTTCATCCATGGCATTTCGGT
>probe:Drosophila_2:1627020_at:231:589; Interrogation_Position=376; Antisense; TGGAGGGCGATCACACAGGCCACTC
>probe:Drosophila_2:1627020_at:396:585; Interrogation_Position=403; Antisense; TGGACAGCAATACCTTTGGACCCGT
>probe:Drosophila_2:1627020_at:184:563; Interrogation_Position=476; Antisense; GGAACGCTGGCGAATACTGGAGAAC
>probe:Drosophila_2:1627020_at:180:569; Interrogation_Position=50; Antisense; GGCATTTCGGTTCTTTGGCAAGTCC
>probe:Drosophila_2:1627020_at:704:583; Interrogation_Position=65; Antisense; TGGCAAGTCCTTGCTGTACGCTCTG

Paste this into a BLAST search page for me
CACTTTCCTGGACTGCGTTGGTTATTGGCCAGGGTGGATGGCATCTCCATTCTCAATCCCGTGCCGGATGAAAAGGAAAAGGACTATGTGTTCCTGCTGCATAATATCGCTCATTTCACCCAAGGGGATCCCGCCCAGAAGATTATCAAGCCACGCTGGGCTACAAGCACGAGATGTTCGCGTACCCGAAGGACATTGTTACCAGTTCATCCATGGCATTTCGGTTGGAGGGCGATCACACAGGCCACTCTGGACAGCAATACCTTTGGACCCGTGGAACGCTGGCGAATACTGGAGAACGGCATTTCGGTTCTTTGGCAAGTCCTGGCAAGTCCTTGCTGTACGCTCTG

Full Affymetrix probeset data:

Annotations for 1627020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720