FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627021_at:

>probe:Drosophila_2:1627021_at:119:57; Interrogation_Position=2514; Antisense; ATGACGATTTGTATGGCCACGACCC
>probe:Drosophila_2:1627021_at:137:261; Interrogation_Position=2531; Antisense; CACGACCCCAAATTCTTGCAGGAGG
>probe:Drosophila_2:1627021_at:33:63; Interrogation_Position=2564; Antisense; ATGTGCGCTCAGGTTGTTGATGCCA
>probe:Drosophila_2:1627021_at:94:449; Interrogation_Position=2582; Antisense; GATGCCATTCTTCTGCAGCTGAAAT
>probe:Drosophila_2:1627021_at:455:237; Interrogation_Position=2604; Antisense; AATCGTTGGGAGTAGCGCAGCAGCA
>probe:Drosophila_2:1627021_at:28:331; Interrogation_Position=2639; Antisense; GCGGAGCTAGCCCTGGAACTTTTTT
>probe:Drosophila_2:1627021_at:259:525; Interrogation_Position=2694; Antisense; GGGAAACTATCGCTCAATTGGCAGT
>probe:Drosophila_2:1627021_at:689:3; Interrogation_Position=2710; Antisense; ATTGGCAGTCAATCTGTGGCTCCTA
>probe:Drosophila_2:1627021_at:481:521; Interrogation_Position=2725; Antisense; GTGGCTCCTAGCTAACAAGGCACAA
>probe:Drosophila_2:1627021_at:485:61; Interrogation_Position=2760; Antisense; ATGTGAAAACACTACCCCAAACTCT
>probe:Drosophila_2:1627021_at:604:167; Interrogation_Position=2815; Antisense; AAAGGATGCATCACCCATAAGGGCT
>probe:Drosophila_2:1627021_at:505:689; Interrogation_Position=2845; Antisense; TATTGCCAAACTGCTACTGCGCGTG
>probe:Drosophila_2:1627021_at:271:695; Interrogation_Position=2949; Antisense; TTTACGGATTCATAGCCCGGTTCTC
>probe:Drosophila_2:1627021_at:78:641; Interrogation_Position=2972; Antisense; TCTCCTACGTTTTTGCTTAACCTTG

Paste this into a BLAST search page for me
ATGACGATTTGTATGGCCACGACCCCACGACCCCAAATTCTTGCAGGAGGATGTGCGCTCAGGTTGTTGATGCCAGATGCCATTCTTCTGCAGCTGAAATAATCGTTGGGAGTAGCGCAGCAGCAGCGGAGCTAGCCCTGGAACTTTTTTGGGAAACTATCGCTCAATTGGCAGTATTGGCAGTCAATCTGTGGCTCCTAGTGGCTCCTAGCTAACAAGGCACAAATGTGAAAACACTACCCCAAACTCTAAAGGATGCATCACCCATAAGGGCTTATTGCCAAACTGCTACTGCGCGTGTTTACGGATTCATAGCCCGGTTCTCTCTCCTACGTTTTTGCTTAACCTTG

Full Affymetrix probeset data:

Annotations for 1627021_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720