FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627022_at:

>probe:Drosophila_2:1627022_at:367:473; Interrogation_Position=406; Antisense; GTTCAATGGCCGCAATTCTGGAGTC
>probe:Drosophila_2:1627022_at:408:245; Interrogation_Position=419; Antisense; AATTCTGGAGTCCTTTCTCGTCAAT
>probe:Drosophila_2:1627022_at:286:639; Interrogation_Position=436; Antisense; TCGTCAATCCCTTTGAGGTGGTCAA
>probe:Drosophila_2:1627022_at:619:537; Interrogation_Position=455; Antisense; GGTCAAGATCACTCAGCAGGCTCAT
>probe:Drosophila_2:1627022_at:595:389; Interrogation_Position=485; Antisense; GAAACGCTTGAAAACACTGTCGGTC
>probe:Drosophila_2:1627022_at:184:531; Interrogation_Position=560; Antisense; GGGTATCACTGCACTAGTGGCTCGA
>probe:Drosophila_2:1627022_at:113:167; Interrogation_Position=584; Antisense; AAATGCCGTCTTTCACTTTGGATTC
>probe:Drosophila_2:1627022_at:190:403; Interrogation_Position=633; Antisense; GACATTGTTCCAAGCCCGGAGGATA
>probe:Drosophila_2:1627022_at:331:211; Interrogation_Position=657; Antisense; AAGACATACAACATCCTGCGAAAGG
>probe:Drosophila_2:1627022_at:261:221; Interrogation_Position=678; Antisense; AAGGTCATCATAGCTGGGTTGGCCA
>probe:Drosophila_2:1627022_at:612:633; Interrogation_Position=705; Antisense; TCCCTGGCTTGCGTGATGAGTGTTA
>probe:Drosophila_2:1627022_at:596:661; Interrogation_Position=754; Antisense; TTCAAGGACCCCAGCCAGTGAAGGG
>probe:Drosophila_2:1627022_at:179:545; Interrogation_Position=830; Antisense; GGAGGGTTTTCGATCGTTGTTCAAG
>probe:Drosophila_2:1627022_at:289:53; Interrogation_Position=897; Antisense; ATGCTCCTGGTGACCTACGAGTATT

Paste this into a BLAST search page for me
GTTCAATGGCCGCAATTCTGGAGTCAATTCTGGAGTCCTTTCTCGTCAATTCGTCAATCCCTTTGAGGTGGTCAAGGTCAAGATCACTCAGCAGGCTCATGAAACGCTTGAAAACACTGTCGGTCGGGTATCACTGCACTAGTGGCTCGAAAATGCCGTCTTTCACTTTGGATTCGACATTGTTCCAAGCCCGGAGGATAAAGACATACAACATCCTGCGAAAGGAAGGTCATCATAGCTGGGTTGGCCATCCCTGGCTTGCGTGATGAGTGTTATTCAAGGACCCCAGCCAGTGAAGGGGGAGGGTTTTCGATCGTTGTTCAAGATGCTCCTGGTGACCTACGAGTATT

Full Affymetrix probeset data:

Annotations for 1627022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720