FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627023_at:

>probe:Drosophila_2:1627023_at:548:601; Interrogation_Position=146; Antisense; TGTTAAGGCGCCCACACAAAATGCT
>probe:Drosophila_2:1627023_at:352:165; Interrogation_Position=164; Antisense; AAATGCTCCGGACTTTTCGTCAAAT
>probe:Drosophila_2:1627023_at:130:163; Interrogation_Position=185; Antisense; AAATAGCCCGACTAGGAAGATCCCT
>probe:Drosophila_2:1627023_at:518:225; Interrogation_Position=210; Antisense; AAGGACGCCATTTCCATCTAAAAGT
>probe:Drosophila_2:1627023_at:542:183; Interrogation_Position=229; Antisense; AAAAGTCTGCCTAAACTCTCAACCA
>probe:Drosophila_2:1627023_at:354:665; Interrogation_Position=275; Antisense; TACACACCAGTGCTTCAGCGTGGAA
>probe:Drosophila_2:1627023_at:645:393; Interrogation_Position=309; Antisense; GAAATCCTCACGAGCATCGGATGAC
>probe:Drosophila_2:1627023_at:523:223; Interrogation_Position=400; Antisense; AAGGTGAACTCACTGCGCGCCGATC
>probe:Drosophila_2:1627023_at:187:431; Interrogation_Position=421; Antisense; GATCTCCTACTGAAAGCTGGCCTGG
>probe:Drosophila_2:1627023_at:156:407; Interrogation_Position=553; Antisense; GACGTAATCCGAGGCTTTAGTCAAT
>probe:Drosophila_2:1627023_at:63:693; Interrogation_Position=568; Antisense; TTTAGTCAATCGAATCCTTCCCATC
>probe:Drosophila_2:1627023_at:674:435; Interrogation_Position=634; Antisense; GAGGAAGGACTCAGCGTCCACCTGA
>probe:Drosophila_2:1627023_at:37:665; Interrogation_Position=664; Antisense; TACAAATCCCTGCTGGTCGAGAATT
>probe:Drosophila_2:1627023_at:544:709; Interrogation_Position=706; Antisense; TTCAAATCCTCAGAGCACGTTGCTC

Paste this into a BLAST search page for me
TGTTAAGGCGCCCACACAAAATGCTAAATGCTCCGGACTTTTCGTCAAATAAATAGCCCGACTAGGAAGATCCCTAAGGACGCCATTTCCATCTAAAAGTAAAAGTCTGCCTAAACTCTCAACCATACACACCAGTGCTTCAGCGTGGAAGAAATCCTCACGAGCATCGGATGACAAGGTGAACTCACTGCGCGCCGATCGATCTCCTACTGAAAGCTGGCCTGGGACGTAATCCGAGGCTTTAGTCAATTTTAGTCAATCGAATCCTTCCCATCGAGGAAGGACTCAGCGTCCACCTGATACAAATCCCTGCTGGTCGAGAATTTTCAAATCCTCAGAGCACGTTGCTC

Full Affymetrix probeset data:

Annotations for 1627023_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720