FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627026_at:

>probe:Drosophila_2:1627026_at:595:705; Interrogation_Position=356; Antisense; TTACGTTCTCCGTGCCCTGGAATAT
>probe:Drosophila_2:1627026_at:674:625; Interrogation_Position=368; Antisense; TGCCCTGGAATATATCCGCACCCAT
>probe:Drosophila_2:1627026_at:181:353; Interrogation_Position=416; Antisense; GCAGCAGTAATCTGGAGTAGCACCA
>probe:Drosophila_2:1627026_at:259:431; Interrogation_Position=430; Antisense; GAGTAGCACCAGCACTCCAAAGCAG
>probe:Drosophila_2:1627026_at:605:209; Interrogation_Position=449; Antisense; AAGCAGCAACCCCACATCTAAACTG
>probe:Drosophila_2:1627026_at:216:195; Interrogation_Position=469; Antisense; AACTGCGGCCAGTCATTGTTATTTA
>probe:Drosophila_2:1627026_at:336:379; Interrogation_Position=629; Antisense; GAAGCGTACACTATCTTCAATAGAA
>probe:Drosophila_2:1627026_at:151:163; Interrogation_Position=656; Antisense; AAATTTCAGGCGGATGGAGTTTACA
>probe:Drosophila_2:1627026_at:62:191; Interrogation_Position=703; Antisense; AACATTGCTCTTTTTTCTTTCAAAT
>probe:Drosophila_2:1627026_at:363:475; Interrogation_Position=750; Antisense; GTTAGTTAATGATTTCGGCAGCCAG
>probe:Drosophila_2:1627026_at:45:19; Interrogation_Position=761; Antisense; ATTTCGGCAGCCAGTAATTGTATAA
>probe:Drosophila_2:1627026_at:291:721; Interrogation_Position=830; Antisense; TTCCACTTTCATTTATACTCAACGC
>probe:Drosophila_2:1627026_at:343:199; Interrogation_Position=850; Antisense; AACGCATTATGATTTCCGAACTACA
>probe:Drosophila_2:1627026_at:287:183; Interrogation_Position=890; Antisense; AAAACCAATCCAGCGGTGATGCACA

Paste this into a BLAST search page for me
TTACGTTCTCCGTGCCCTGGAATATTGCCCTGGAATATATCCGCACCCATGCAGCAGTAATCTGGAGTAGCACCAGAGTAGCACCAGCACTCCAAAGCAGAAGCAGCAACCCCACATCTAAACTGAACTGCGGCCAGTCATTGTTATTTAGAAGCGTACACTATCTTCAATAGAAAAATTTCAGGCGGATGGAGTTTACAAACATTGCTCTTTTTTCTTTCAAATGTTAGTTAATGATTTCGGCAGCCAGATTTCGGCAGCCAGTAATTGTATAATTCCACTTTCATTTATACTCAACGCAACGCATTATGATTTCCGAACTACAAAAACCAATCCAGCGGTGATGCACA

Full Affymetrix probeset data:

Annotations for 1627026_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720