FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627027_at:

>probe:Drosophila_2:1627027_at:566:279; Interrogation_Position=105; Antisense; CTAATTGCCGGATTTGCCAGCCTGG
>probe:Drosophila_2:1627027_at:65:127; Interrogation_Position=123; Antisense; AGCCTGGCACATGCTGCTTTTTCTG
>probe:Drosophila_2:1627027_at:328:37; Interrogation_Position=154; Antisense; ATCATCGCACCTATTTGAGGCTGAC
>probe:Drosophila_2:1627027_at:66:127; Interrogation_Position=195; Antisense; AGCCTTCCATTGGACATTATCCTGC
>probe:Drosophila_2:1627027_at:176:15; Interrogation_Position=210; Antisense; ATTATCCTGCAGACCGTCATCAGTT
>probe:Drosophila_2:1627027_at:322:461; Interrogation_Position=245; Antisense; GATTTACAACATCATCGAGATCGTT
>probe:Drosophila_2:1627027_at:413:189; Interrogation_Position=273; Antisense; AACTTCAAGGAAATTCGCGCCACCG
>probe:Drosophila_2:1627027_at:222:323; Interrogation_Position=289; Antisense; GCGCCACCGTGGACATGCAACAGAA
>probe:Drosophila_2:1627027_at:180:385; Interrogation_Position=29; Antisense; GAAAATTGTACCGACTGTGATTGTA
>probe:Drosophila_2:1627027_at:126:261; Interrogation_Position=309; Antisense; CAGAAAACTTGGGACACCTTGGGCA
>probe:Drosophila_2:1627027_at:183:473; Interrogation_Position=344; Antisense; GTTCTATTCCTTCAATCACCGTGGT
>probe:Drosophila_2:1627027_at:357:519; Interrogation_Position=364; Antisense; GTGGTCGTGCCTTAAATCCTGGATA
>probe:Drosophila_2:1627027_at:345:423; Interrogation_Position=405; Antisense; GAGACCTTTCTTTTAAGTTCTGCTA
>probe:Drosophila_2:1627027_at:329:187; Interrogation_Position=93; Antisense; AACAAACTCTTGCTAATTGCCGGAT

Paste this into a BLAST search page for me
CTAATTGCCGGATTTGCCAGCCTGGAGCCTGGCACATGCTGCTTTTTCTGATCATCGCACCTATTTGAGGCTGACAGCCTTCCATTGGACATTATCCTGCATTATCCTGCAGACCGTCATCAGTTGATTTACAACATCATCGAGATCGTTAACTTCAAGGAAATTCGCGCCACCGGCGCCACCGTGGACATGCAACAGAAGAAAATTGTACCGACTGTGATTGTACAGAAAACTTGGGACACCTTGGGCAGTTCTATTCCTTCAATCACCGTGGTGTGGTCGTGCCTTAAATCCTGGATAGAGACCTTTCTTTTAAGTTCTGCTAAACAAACTCTTGCTAATTGCCGGAT

Full Affymetrix probeset data:

Annotations for 1627027_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720