FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627028_at:

>probe:Drosophila_2:1627028_at:440:241; Interrogation_Position=418; Antisense; AATACAAGCAATTGCGCCGCTTTCG
>probe:Drosophila_2:1627028_at:677:319; Interrogation_Position=433; Antisense; GCCGCTTTCGTATCATCGGATGCAT
>probe:Drosophila_2:1627028_at:591:559; Interrogation_Position=475; Antisense; GGACAATACTGCTATACGCCTTGGC
>probe:Drosophila_2:1627028_at:143:253; Interrogation_Position=506; Antisense; CAAGCCGCATTACATTGGTCCATGG
>probe:Drosophila_2:1627028_at:65:461; Interrogation_Position=536; Antisense; GATTTATGCCACCATTACATCCATC
>probe:Drosophila_2:1627028_at:482:535; Interrogation_Position=572; Antisense; GGTGCTGTCAGATGCCTTAGTGAAC
>probe:Drosophila_2:1627028_at:251:679; Interrogation_Position=604; Antisense; TAGGCAACGGCTTCTTGTTCAAGAC
>probe:Drosophila_2:1627028_at:586:449; Interrogation_Position=632; Antisense; GATCCCGGTTATCAACTTGTACTGT
>probe:Drosophila_2:1627028_at:258:489; Interrogation_Position=650; Antisense; GTACTGTGTCCTTTCTATGTCTAAA
>probe:Drosophila_2:1627028_at:126:467; Interrogation_Position=732; Antisense; GTTGCAAAGACGTTCAGACCCGCCA
>probe:Drosophila_2:1627028_at:720:213; Interrogation_Position=798; Antisense; AAGTTGGTGGCAGTTCCCCAGCGAA
>probe:Drosophila_2:1627028_at:652:79; Interrogation_Position=856; Antisense; AGGTGTTTGCTTCAGGTGTTCCAAC
>probe:Drosophila_2:1627028_at:727:555; Interrogation_Position=872; Antisense; TGTTCCAACGGGATTAGCGGTTCTT
>probe:Drosophila_2:1627028_at:127:497; Interrogation_Position=899; Antisense; GTCAGTGTTCAAGGTTCAACGCCAT

Paste this into a BLAST search page for me
AATACAAGCAATTGCGCCGCTTTCGGCCGCTTTCGTATCATCGGATGCATGGACAATACTGCTATACGCCTTGGCCAAGCCGCATTACATTGGTCCATGGGATTTATGCCACCATTACATCCATCGGTGCTGTCAGATGCCTTAGTGAACTAGGCAACGGCTTCTTGTTCAAGACGATCCCGGTTATCAACTTGTACTGTGTACTGTGTCCTTTCTATGTCTAAAGTTGCAAAGACGTTCAGACCCGCCAAAGTTGGTGGCAGTTCCCCAGCGAAAGGTGTTTGCTTCAGGTGTTCCAACTGTTCCAACGGGATTAGCGGTTCTTGTCAGTGTTCAAGGTTCAACGCCAT

Full Affymetrix probeset data:

Annotations for 1627028_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720