FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627033_at:

>probe:Drosophila_2:1627033_at:47:79; Interrogation_Position=1943; Antisense; AGGATTGCCTGCTCAACCATGAGAT
>probe:Drosophila_2:1627033_at:634:57; Interrogation_Position=1961; Antisense; ATGAGATTGTGACCGTGTGTCGCTT
>probe:Drosophila_2:1627033_at:540:341; Interrogation_Position=1982; Antisense; GCTTTTTCTCGGCTGAGCAGGCAAT
>probe:Drosophila_2:1627033_at:164:233; Interrogation_Position=2004; Antisense; AATGCCTCCCAGCTGCGATAGGAAT
>probe:Drosophila_2:1627033_at:559:419; Interrogation_Position=2063; Antisense; GAGCTTTGTGGAACGGCATGGATCA
>probe:Drosophila_2:1627033_at:655:453; Interrogation_Position=2095; Antisense; GATCATCTGAGCCACATTAATCCGG
>probe:Drosophila_2:1627033_at:141:575; Interrogation_Position=2118; Antisense; GGCGTGCAAGCCGTACATCAGTGAA
>probe:Drosophila_2:1627033_at:367:511; Interrogation_Position=2149; Antisense; GTGAGGTCTACTTTGCGAGGCTGCC
>probe:Drosophila_2:1627033_at:65:273; Interrogation_Position=2205; Antisense; CATACTGATGGTGCTGCAGCGCAAC
>probe:Drosophila_2:1627033_at:173:135; Interrogation_Position=2237; Antisense; ACGAAATCGAGGTGCGCGACTTTCT
>probe:Drosophila_2:1627033_at:134:277; Interrogation_Position=2268; Antisense; CTTCAACATGCGCAACGACCAAGTG
>probe:Drosophila_2:1627033_at:306:157; Interrogation_Position=2351; Antisense; ACAAAGGGCGCCTGGTGGACTTCAC
>probe:Drosophila_2:1627033_at:708:585; Interrogation_Position=2366; Antisense; TGGACTTCACCTGGTTCCTAGACTA
>probe:Drosophila_2:1627033_at:62:511; Interrogation_Position=2512; Antisense; GTGAACATCGTGCTTAAGACCTAAA

Paste this into a BLAST search page for me
AGGATTGCCTGCTCAACCATGAGATATGAGATTGTGACCGTGTGTCGCTTGCTTTTTCTCGGCTGAGCAGGCAATAATGCCTCCCAGCTGCGATAGGAATGAGCTTTGTGGAACGGCATGGATCAGATCATCTGAGCCACATTAATCCGGGGCGTGCAAGCCGTACATCAGTGAAGTGAGGTCTACTTTGCGAGGCTGCCCATACTGATGGTGCTGCAGCGCAACACGAAATCGAGGTGCGCGACTTTCTCTTCAACATGCGCAACGACCAAGTGACAAAGGGCGCCTGGTGGACTTCACTGGACTTCACCTGGTTCCTAGACTAGTGAACATCGTGCTTAAGACCTAAA

Full Affymetrix probeset data:

Annotations for 1627033_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720