FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627036_at:

>probe:Drosophila_2:1627036_at:99:447; Interrogation_Position=1065; Antisense; GATGCTATCTCATATGCCTACTGTA
>probe:Drosophila_2:1627036_at:550:179; Interrogation_Position=1096; Antisense; AAACATAAGCTAGTTGTGCAACAGG
>probe:Drosophila_2:1627036_at:308:15; Interrogation_Position=1181; Antisense; ATCATTTTCGTTTTATTCCTAAGCG
>probe:Drosophila_2:1627036_at:540:327; Interrogation_Position=1203; Antisense; GCGTATAAACCGACAAATGGCCAAA
>probe:Drosophila_2:1627036_at:711:103; Interrogation_Position=1235; Antisense; AGACATTAGCAGCAGAGCGTTCATT
>probe:Drosophila_2:1627036_at:369:103; Interrogation_Position=1248; Antisense; AGAGCGTTCATTAGACATGGTGGAA
>probe:Drosophila_2:1627036_at:494:83; Interrogation_Position=1318; Antisense; AGTGAAATCGGAGAGCTGTCAATTC
>probe:Drosophila_2:1627036_at:291:417; Interrogation_Position=1330; Antisense; GAGCTGTCAATTCTTTCAGATGGGA
>probe:Drosophila_2:1627036_at:346:651; Interrogation_Position=1405; Antisense; TCAAACATGTCATTGGTACCACAAG
>probe:Drosophila_2:1627036_at:511:589; Interrogation_Position=1443; Antisense; TGGATTGTTTTCAGATGCCGATACA
>probe:Drosophila_2:1627036_at:626:151; Interrogation_Position=1471; Antisense; ACATCAACGATGTGTGCGAAGTTAA
>probe:Drosophila_2:1627036_at:452:7; Interrogation_Position=1508; Antisense; ATTCCGAAGTGTTTAAGGACCTGTG
>probe:Drosophila_2:1627036_at:38:617; Interrogation_Position=965; Antisense; TGCAACTACTGCAAAAACGCTCCCT
>probe:Drosophila_2:1627036_at:217:175; Interrogation_Position=979; Antisense; AAACGCTCCCTAAAGCAGTCAATAG

Paste this into a BLAST search page for me
GATGCTATCTCATATGCCTACTGTAAAACATAAGCTAGTTGTGCAACAGGATCATTTTCGTTTTATTCCTAAGCGGCGTATAAACCGACAAATGGCCAAAAGACATTAGCAGCAGAGCGTTCATTAGAGCGTTCATTAGACATGGTGGAAAGTGAAATCGGAGAGCTGTCAATTCGAGCTGTCAATTCTTTCAGATGGGATCAAACATGTCATTGGTACCACAAGTGGATTGTTTTCAGATGCCGATACAACATCAACGATGTGTGCGAAGTTAAATTCCGAAGTGTTTAAGGACCTGTGTGCAACTACTGCAAAAACGCTCCCTAAACGCTCCCTAAAGCAGTCAATAG

Full Affymetrix probeset data:

Annotations for 1627036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720