Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627038_at:

>probe:Drosophila_2:1627038_at:520:701; Interrogation_Position=1398; Antisense; TTTTGGCATGTCTCCCCAGATGGGA
>probe:Drosophila_2:1627038_at:600:593; Interrogation_Position=1487; Antisense; TGGGAATGAACCCATTCGGACCCTT
>probe:Drosophila_2:1627038_at:597:247; Interrogation_Position=1521; Antisense; CAATCCTTTCAATCCTTTCAACAGA
>probe:Drosophila_2:1627038_at:658:227; Interrogation_Position=1582; Antisense; AATGGTAACTTTTTCCAGCGCGTCT
>probe:Drosophila_2:1627038_at:503:123; Interrogation_Position=1598; Antisense; AGCGCGTCTTCAAATTCAACCAGGA
>probe:Drosophila_2:1627038_at:319:215; Interrogation_Position=1677; Antisense; AAGATCGGGCAAGCTGAACTTCTCG
>probe:Drosophila_2:1627038_at:505:613; Interrogation_Position=1691; Antisense; TGAACTTCTCGAGTAGCACTCCGGC
>probe:Drosophila_2:1627038_at:729:337; Interrogation_Position=1724; Antisense; GCTCAGAACAGCCAGATACCATTGT
>probe:Drosophila_2:1627038_at:353:573; Interrogation_Position=1773; Antisense; GGCTGAGGACTCTGCTGAAGATTTT
>probe:Drosophila_2:1627038_at:724:441; Interrogation_Position=1807; Antisense; GATGATACGGCGATGACCACACCGC
>probe:Drosophila_2:1627038_at:606:415; Interrogation_Position=1843; Antisense; GAGCCAGATGATTCCGCTGACACAT
>probe:Drosophila_2:1627038_at:555:427; Interrogation_Position=1871; Antisense; GAGTTCCGGCCATTGTGAGCAAGGC
>probe:Drosophila_2:1627038_at:600:407; Interrogation_Position=1896; Antisense; GACGGAACTGCTCAAGCCAACGGAG
>probe:Drosophila_2:1627038_at:495:555; Interrogation_Position=1951; Antisense; GGACGTAGTCCCCAAAAGCATAGAT

Paste this into a BLAST search page for me
TTTTGGCATGTCTCCCCAGATGGGATGGGAATGAACCCATTCGGACCCTTCAATCCTTTCAATCCTTTCAACAGAAATGGTAACTTTTTCCAGCGCGTCTAGCGCGTCTTCAAATTCAACCAGGAAAGATCGGGCAAGCTGAACTTCTCGTGAACTTCTCGAGTAGCACTCCGGCGCTCAGAACAGCCAGATACCATTGTGGCTGAGGACTCTGCTGAAGATTTTGATGATACGGCGATGACCACACCGCGAGCCAGATGATTCCGCTGACACATGAGTTCCGGCCATTGTGAGCAAGGCGACGGAACTGCTCAAGCCAACGGAGGGACGTAGTCCCCAAAAGCATAGAT

Full Affymetrix probeset data:

Annotations for 1627038_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime