FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627040_at:

>probe:Drosophila_2:1627040_at:313:559; Interrogation_Position=1676; Antisense; GGACAATACAGACCACCTTCAACAG
>probe:Drosophila_2:1627040_at:16:81; Interrogation_Position=1699; Antisense; AGGGCTACCAAGTGGATCACGCTGT
>probe:Drosophila_2:1627040_at:101:455; Interrogation_Position=1713; Antisense; GATCACGCTGTAACCGACTCTGAAA
>probe:Drosophila_2:1627040_at:661:195; Interrogation_Position=1769; Antisense; AACTGGCAAATCTTTATCGCCCTCA
>probe:Drosophila_2:1627040_at:443:635; Interrogation_Position=1785; Antisense; TCGCCCTCATATCGCACTGGAAAAT
>probe:Drosophila_2:1627040_at:633:423; Interrogation_Position=1833; Antisense; GAGACAATATCCCAGACAGAACAGA
>probe:Drosophila_2:1627040_at:193:93; Interrogation_Position=1859; Antisense; AGTTATCGATGATCTCAGTGAGCTG
>probe:Drosophila_2:1627040_at:509:65; Interrogation_Position=1947; Antisense; ATGGAACCGATCATCGAAATCCGGA
>probe:Drosophila_2:1627040_at:397:235; Interrogation_Position=1964; Antisense; AATCCGGACTAGTACCTGTGAGACA
>probe:Drosophila_2:1627040_at:42:487; Interrogation_Position=1975; Antisense; GTACCTGTGAGACACCGGAGCAAAT
>probe:Drosophila_2:1627040_at:145:241; Interrogation_Position=1997; Antisense; AATAAGCAGCCGTTTTGCTGCTGCT
>probe:Drosophila_2:1627040_at:376:335; Interrogation_Position=2019; Antisense; GCTGCGTCAGCCGTGAACTGTAATG
>probe:Drosophila_2:1627040_at:292:195; Interrogation_Position=2034; Antisense; AACTGTAATGAGCTGTGTGCCGATC
>probe:Drosophila_2:1627040_at:492:509; Interrogation_Position=2109; Antisense; GTGACGAATGTATCAACGCTTTAAT

Paste this into a BLAST search page for me
GGACAATACAGACCACCTTCAACAGAGGGCTACCAAGTGGATCACGCTGTGATCACGCTGTAACCGACTCTGAAAAACTGGCAAATCTTTATCGCCCTCATCGCCCTCATATCGCACTGGAAAATGAGACAATATCCCAGACAGAACAGAAGTTATCGATGATCTCAGTGAGCTGATGGAACCGATCATCGAAATCCGGAAATCCGGACTAGTACCTGTGAGACAGTACCTGTGAGACACCGGAGCAAATAATAAGCAGCCGTTTTGCTGCTGCTGCTGCGTCAGCCGTGAACTGTAATGAACTGTAATGAGCTGTGTGCCGATCGTGACGAATGTATCAACGCTTTAAT

Full Affymetrix probeset data:

Annotations for 1627040_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720