FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627043_at:

>probe:Drosophila_2:1627043_at:46:707; Interrogation_Position=2601; Antisense; TTAGACAGCCAAACCTTGCGCATTT
>probe:Drosophila_2:1627043_at:442:175; Interrogation_Position=2611; Antisense; AAACCTTGCGCATTTCTGAGAATTG
>probe:Drosophila_2:1627043_at:9:405; Interrogation_Position=2656; Antisense; GACTCATGAGTATTTATGTCACCAC
>probe:Drosophila_2:1627043_at:327:61; Interrogation_Position=2671; Antisense; ATGTCACCACTCACTATACTCGAAA
>probe:Drosophila_2:1627043_at:71:661; Interrogation_Position=2687; Antisense; TACTCGAAACATATTTCCTGCCCGC
>probe:Drosophila_2:1627043_at:196:301; Interrogation_Position=2709; Antisense; CGCCTATTTATCTTCCATTTCTTAT
>probe:Drosophila_2:1627043_at:430:645; Interrogation_Position=2728; Antisense; TCTTATTTATATACGTCCGCCTGTC
>probe:Drosophila_2:1627043_at:340:303; Interrogation_Position=2744; Antisense; CCGCCTGTCCAAAGATTCTGCTGAA
>probe:Drosophila_2:1627043_at:28:141; Interrogation_Position=2770; Antisense; ACGGTTTATAGATCTAGTGTCTCAA
>probe:Drosophila_2:1627043_at:213:667; Interrogation_Position=2825; Antisense; TACTATTTATTTCTCTCACTGCATT
>probe:Drosophila_2:1627043_at:53:145; Interrogation_Position=2842; Antisense; ACTGCATTACGTGTTTAGCATTTAA
>probe:Drosophila_2:1627043_at:337:541; Interrogation_Position=2896; Antisense; GGATGTTTTGGTTCTTCGAAGACGC
>probe:Drosophila_2:1627043_at:91:207; Interrogation_Position=2940; Antisense; AAGCTTTAGTGCCTCTGTATGATGA
>probe:Drosophila_2:1627043_at:5:477; Interrogation_Position=3131; Antisense; GTTTTCCTTTTGATTTACACACACG

Paste this into a BLAST search page for me
TTAGACAGCCAAACCTTGCGCATTTAAACCTTGCGCATTTCTGAGAATTGGACTCATGAGTATTTATGTCACCACATGTCACCACTCACTATACTCGAAATACTCGAAACATATTTCCTGCCCGCCGCCTATTTATCTTCCATTTCTTATTCTTATTTATATACGTCCGCCTGTCCCGCCTGTCCAAAGATTCTGCTGAAACGGTTTATAGATCTAGTGTCTCAATACTATTTATTTCTCTCACTGCATTACTGCATTACGTGTTTAGCATTTAAGGATGTTTTGGTTCTTCGAAGACGCAAGCTTTAGTGCCTCTGTATGATGAGTTTTCCTTTTGATTTACACACACG

Full Affymetrix probeset data:

Annotations for 1627043_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720