FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627045_at:

>probe:Drosophila_2:1627045_at:664:327; Interrogation_Position=189; Antisense; GCGTGTCCTACCAATCCTTAAAGTG
>probe:Drosophila_2:1627045_at:272:113; Interrogation_Position=221; Antisense; AGCAGATCCGGTCCAAGTCCTTGAT
>probe:Drosophila_2:1627045_at:260:151; Interrogation_Position=254; Antisense; ACATCGATTTCGAGTGGCTGGCCCA
>probe:Drosophila_2:1627045_at:339:137; Interrogation_Position=278; Antisense; ACGATACCAAGTGTGATGCCTCCCT
>probe:Drosophila_2:1627045_at:667:179; Interrogation_Position=334; Antisense; AAACAGTGCGCCCAGGTGATCTTTG
>probe:Drosophila_2:1627045_at:531:623; Interrogation_Position=367; Antisense; TGCGATTATTCCTTGGCTGCAGTAA
>probe:Drosophila_2:1627045_at:511:567; Interrogation_Position=421; Antisense; GGCACCCCACTCATATCAGTTGGAG
>probe:Drosophila_2:1627045_at:669:723; Interrogation_Position=440; Antisense; TTGGAGGTTCCACCTATGACTTTGA
>probe:Drosophila_2:1627045_at:632:409; Interrogation_Position=487; Antisense; GACGAGTTCTATATGCTGTTGCGCA
>probe:Drosophila_2:1627045_at:6:105; Interrogation_Position=530; Antisense; AGACGATTTCCGAGCTGACCATAAA
>probe:Drosophila_2:1627045_at:230:503; Interrogation_Position=576; Antisense; GTCGCATTCCATCTTCTACTATGAA
>probe:Drosophila_2:1627045_at:444:357; Interrogation_Position=630; Antisense; GCACACCTGCTTTCTCATGATGAAA
>probe:Drosophila_2:1627045_at:108:423; Interrogation_Position=679; Antisense; GAGAACATGACATTCGCCCAGTTTC
>probe:Drosophila_2:1627045_at:109:415; Interrogation_Position=709; Antisense; GAGCCCAACTTGACAAATCGCACGG

Paste this into a BLAST search page for me
GCGTGTCCTACCAATCCTTAAAGTGAGCAGATCCGGTCCAAGTCCTTGATACATCGATTTCGAGTGGCTGGCCCAACGATACCAAGTGTGATGCCTCCCTAAACAGTGCGCCCAGGTGATCTTTGTGCGATTATTCCTTGGCTGCAGTAAGGCACCCCACTCATATCAGTTGGAGTTGGAGGTTCCACCTATGACTTTGAGACGAGTTCTATATGCTGTTGCGCAAGACGATTTCCGAGCTGACCATAAAGTCGCATTCCATCTTCTACTATGAAGCACACCTGCTTTCTCATGATGAAAGAGAACATGACATTCGCCCAGTTTCGAGCCCAACTTGACAAATCGCACGG

Full Affymetrix probeset data:

Annotations for 1627045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720