FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627046_at:

>probe:Drosophila_2:1627046_at:262:497; Interrogation_Position=464; Antisense; GGTCTTTTTCCTGAAGGCCAACGCA
>probe:Drosophila_2:1627046_at:339:311; Interrogation_Position=480; Antisense; GCCAACGCAGGCACCTTCTTTGTGG
>probe:Drosophila_2:1627046_at:185:613; Interrogation_Position=543; Antisense; TAGGAGCACTCCACTTACCTACGTA
>probe:Drosophila_2:1627046_at:553:447; Interrogation_Position=606; Antisense; GATGCCCAGCGCCAGATGATAACAA
>probe:Drosophila_2:1627046_at:277:255; Interrogation_Position=628; Antisense; CAACAAGCTCGGCAGTGGAACTCAG
>probe:Drosophila_2:1627046_at:211:679; Interrogation_Position=663; Antisense; TATAACAAAGCCAGCCAGCGGTCTC
>probe:Drosophila_2:1627046_at:352:263; Interrogation_Position=678; Antisense; CAGCGGTCTCACGATTATCAGCAAA
>probe:Drosophila_2:1627046_at:93:201; Interrogation_Position=757; Antisense; AACGCTAACTACTATTACGATGTCA
>probe:Drosophila_2:1627046_at:284:443; Interrogation_Position=775; Antisense; GATGTCAACAAAATGGGCCGCCAGC
>probe:Drosophila_2:1627046_at:613:19; Interrogation_Position=808; Antisense; ATTTGTGTCCCATTGTTGCCGGTAC
>probe:Drosophila_2:1627046_at:93:669; Interrogation_Position=830; Antisense; TACTCTCGCTTTACGATCCACGGAA
>probe:Drosophila_2:1627046_at:655:133; Interrogation_Position=842; Antisense; ACGATCCACGGAACCCTAGAATTAT
>probe:Drosophila_2:1627046_at:292:59; Interrogation_Position=867; Antisense; ATGTTCTGCGAACACCTGGATCTCG
>probe:Drosophila_2:1627046_at:587:185; Interrogation_Position=877; Antisense; AACACCTGGATCTCGCGATCTAATT

Paste this into a BLAST search page for me
GGTCTTTTTCCTGAAGGCCAACGCAGCCAACGCAGGCACCTTCTTTGTGGTAGGAGCACTCCACTTACCTACGTAGATGCCCAGCGCCAGATGATAACAACAACAAGCTCGGCAGTGGAACTCAGTATAACAAAGCCAGCCAGCGGTCTCCAGCGGTCTCACGATTATCAGCAAAAACGCTAACTACTATTACGATGTCAGATGTCAACAAAATGGGCCGCCAGCATTTGTGTCCCATTGTTGCCGGTACTACTCTCGCTTTACGATCCACGGAAACGATCCACGGAACCCTAGAATTATATGTTCTGCGAACACCTGGATCTCGAACACCTGGATCTCGCGATCTAATT

Full Affymetrix probeset data:

Annotations for 1627046_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720