FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627047_at:

>probe:Drosophila_2:1627047_at:388:441; Interrogation_Position=1095; Antisense; GATGGATGGACTCTATGTGACGACA
>probe:Drosophila_2:1627047_at:677:255; Interrogation_Position=1145; Antisense; CAAAGGCTCGCAGAACAGCGGGTCA
>probe:Drosophila_2:1627047_at:475:537; Interrogation_Position=1165; Antisense; GGTCACCTGAACATCTGGTCGACGA
>probe:Drosophila_2:1627047_at:162:405; Interrogation_Position=1194; Antisense; GACTACAACGTTTCAGTTCAGCGAA
>probe:Drosophila_2:1627047_at:256:471; Interrogation_Position=1209; Antisense; GTTCAGCGAAGGAGACGCCGTCCAA
>probe:Drosophila_2:1627047_at:90:205; Interrogation_Position=1232; Antisense; AAGCCGTCACCACTTTGTGAGATCA
>probe:Drosophila_2:1627047_at:208:427; Interrogation_Position=1250; Antisense; GAGATCAGCCTACAGCAAACGCAAT
>probe:Drosophila_2:1627047_at:292:177; Interrogation_Position=1266; Antisense; AAACGCAATCGCAAGCACAACTGAT
>probe:Drosophila_2:1627047_at:616:45; Interrogation_Position=880; Antisense; ATCCCTACGGATACATTCTGCAAAA
>probe:Drosophila_2:1627047_at:225:617; Interrogation_Position=898; Antisense; TGCAAAATGGTCTGCCCGCCCAGTG
>probe:Drosophila_2:1627047_at:667:515; Interrogation_Position=920; Antisense; GTGTGCCGGTTGTTTCCAGGGATAC
>probe:Drosophila_2:1627047_at:277:81; Interrogation_Position=937; Antisense; AGGGATACGGAGCTCCCCTCATGTA
>probe:Drosophila_2:1627047_at:193:301; Interrogation_Position=952; Antisense; CCCTCATGTATAATCCTCCTTGGAT
>probe:Drosophila_2:1627047_at:638:515; Interrogation_Position=993; Antisense; GTGGCATATCCAGCCTTTAACAATA

Paste this into a BLAST search page for me
GATGGATGGACTCTATGTGACGACACAAAGGCTCGCAGAACAGCGGGTCAGGTCACCTGAACATCTGGTCGACGAGACTACAACGTTTCAGTTCAGCGAAGTTCAGCGAAGGAGACGCCGTCCAAAAGCCGTCACCACTTTGTGAGATCAGAGATCAGCCTACAGCAAACGCAATAAACGCAATCGCAAGCACAACTGATATCCCTACGGATACATTCTGCAAAATGCAAAATGGTCTGCCCGCCCAGTGGTGTGCCGGTTGTTTCCAGGGATACAGGGATACGGAGCTCCCCTCATGTACCCTCATGTATAATCCTCCTTGGATGTGGCATATCCAGCCTTTAACAATA

Full Affymetrix probeset data:

Annotations for 1627047_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720