FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627048_at:

>probe:Drosophila_2:1627048_at:37:465; Interrogation_Position=1018; Antisense; GATTCCCGCTTGCTTAGCTTATAAG
>probe:Drosophila_2:1627048_at:24:529; Interrogation_Position=490; Antisense; GGGACTGATGCATCTCTCTGGACGA
>probe:Drosophila_2:1627048_at:350:719; Interrogation_Position=548; Antisense; TTCGCCGCTGGCGTTAACTCGGAAA
>probe:Drosophila_2:1627048_at:376:663; Interrogation_Position=577; Antisense; TAAATTGTACGACCTTCGCTCTTTC
>probe:Drosophila_2:1627048_at:435:369; Interrogation_Position=644; Antisense; GAATGCGACTGGACTGGCCTTAAGT
>probe:Drosophila_2:1627048_at:17:371; Interrogation_Position=703; Antisense; GAATGGATCGGTCATCCGGCTCGTA
>probe:Drosophila_2:1627048_at:71:279; Interrogation_Position=749; Antisense; CTACAAACGTTCACGGGCTATCCAA
>probe:Drosophila_2:1627048_at:591:221; Interrogation_Position=779; Antisense; AAGGGCATTCCCATCGAGGCAAGCT
>probe:Drosophila_2:1627048_at:43:105; Interrogation_Position=811; Antisense; AGACTCGCAGTTCATCTTTTCAGGC
>probe:Drosophila_2:1627048_at:185:699; Interrogation_Position=827; Antisense; TTTTCAGGCAGCACCGATGGACGAG
>probe:Drosophila_2:1627048_at:211:433; Interrogation_Position=849; Antisense; GAGTGCACATCTGGAATGCCGACAC
>probe:Drosophila_2:1627048_at:259:533; Interrogation_Position=916; Antisense; GGTGCAATGCGTTCAGTTCAATCCA
>probe:Drosophila_2:1627048_at:137:165; Interrogation_Position=941; Antisense; AAATACATGATGCTGGCGTCCGCGT
>probe:Drosophila_2:1627048_at:526:189; Interrogation_Position=971; Antisense; AACATGGCTTTTTGGCTGCCCACAT

Paste this into a BLAST search page for me
GATTCCCGCTTGCTTAGCTTATAAGGGGACTGATGCATCTCTCTGGACGATTCGCCGCTGGCGTTAACTCGGAAATAAATTGTACGACCTTCGCTCTTTCGAATGCGACTGGACTGGCCTTAAGTGAATGGATCGGTCATCCGGCTCGTACTACAAACGTTCACGGGCTATCCAAAAGGGCATTCCCATCGAGGCAAGCTAGACTCGCAGTTCATCTTTTCAGGCTTTTCAGGCAGCACCGATGGACGAGGAGTGCACATCTGGAATGCCGACACGGTGCAATGCGTTCAGTTCAATCCAAAATACATGATGCTGGCGTCCGCGTAACATGGCTTTTTGGCTGCCCACAT

Full Affymetrix probeset data:

Annotations for 1627048_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720