FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627050_at:

>probe:Drosophila_2:1627050_at:578:89; Interrogation_Position=1019; Antisense; AGTAGTAAACTATTCGTCACCCGAG
>probe:Drosophila_2:1627050_at:557:247; Interrogation_Position=490; Antisense; AATTGAGCCGGTGGATCAGCATGCC
>probe:Drosophila_2:1627050_at:242:627; Interrogation_Position=511; Antisense; TGCCAAGGCCAATTGCGAATGCTAT
>probe:Drosophila_2:1627050_at:197:257; Interrogation_Position=571; Antisense; CAAAGATAAAGTGTCCCTGCTGGAG
>probe:Drosophila_2:1627050_at:467:487; Interrogation_Position=602; Antisense; GTACGCAGCCTAAAGCCTGGAGGAT
>probe:Drosophila_2:1627050_at:38:449; Interrogation_Position=624; Antisense; GATCCATCTTTATCACCACTTTGAA
>probe:Drosophila_2:1627050_at:51:639; Interrogation_Position=669; Antisense; TCGGTGGCGTGTTACTCAGCGAGTA
>probe:Drosophila_2:1627050_at:548:429; Interrogation_Position=689; Antisense; GAGTATGTTCTCAATCTGGTGCCCA
>probe:Drosophila_2:1627050_at:207:231; Interrogation_Position=736; Antisense; AATGATTTCGCCCTTGGACGTTCAG
>probe:Drosophila_2:1627050_at:306:409; Interrogation_Position=752; Antisense; GACGTTCAGCGCATCTTGGATACGA
>probe:Drosophila_2:1627050_at:563:71; Interrogation_Position=808; Antisense; AGGCTATTCTTTATTCTCTCGTTCA
>probe:Drosophila_2:1627050_at:162:375; Interrogation_Position=867; Antisense; GAAGCACCTACGACTTTTGGAGCAA
>probe:Drosophila_2:1627050_at:102:693; Interrogation_Position=882; Antisense; TTTGGAGCAACACCTGGCGATGGAT
>probe:Drosophila_2:1627050_at:730:201; Interrogation_Position=914; Antisense; AACCAGATGTGCTACGCCTTGCAGG

Paste this into a BLAST search page for me
AGTAGTAAACTATTCGTCACCCGAGAATTGAGCCGGTGGATCAGCATGCCTGCCAAGGCCAATTGCGAATGCTATCAAAGATAAAGTGTCCCTGCTGGAGGTACGCAGCCTAAAGCCTGGAGGATGATCCATCTTTATCACCACTTTGAATCGGTGGCGTGTTACTCAGCGAGTAGAGTATGTTCTCAATCTGGTGCCCAAATGATTTCGCCCTTGGACGTTCAGGACGTTCAGCGCATCTTGGATACGAAGGCTATTCTTTATTCTCTCGTTCAGAAGCACCTACGACTTTTGGAGCAATTTGGAGCAACACCTGGCGATGGATAACCAGATGTGCTACGCCTTGCAGG

Full Affymetrix probeset data:

Annotations for 1627050_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720