FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627051_at:

>probe:Drosophila_2:1627051_at:225:557; Interrogation_Position=108; Antisense; GGACTTTAACTACGCTTATGAGCTA
>probe:Drosophila_2:1627051_at:383:57; Interrogation_Position=125; Antisense; ATGAGCTATCCAACCATATTCGCGC
>probe:Drosophila_2:1627051_at:379:21; Interrogation_Position=140; Antisense; ATATTCGCGCCGTGCAAACTGGAGC
>probe:Drosophila_2:1627051_at:641:373; Interrogation_Position=15; Antisense; GAAGTTTGTGATCGTTCTTGCCTGC
>probe:Drosophila_2:1627051_at:429:553; Interrogation_Position=160; Antisense; GGAGCCTTGAAGGAGCACGACAACT
>probe:Drosophila_2:1627051_at:418:103; Interrogation_Position=173; Antisense; AGCACGACAACTGGGTGGTTTCCGG
>probe:Drosophila_2:1627051_at:18:169; Interrogation_Position=235; Antisense; AAAGTGGTCTACACCGCCGATGAAA
>probe:Drosophila_2:1627051_at:103:393; Interrogation_Position=253; Antisense; GATGAAACCGGCTACCACCCAAAGG
>probe:Drosophila_2:1627051_at:343:567; Interrogation_Position=262; Antisense; GGCTACCACCCAAAGGTCGTCGAGG
>probe:Drosophila_2:1627051_at:429:713; Interrogation_Position=29; Antisense; TTCTTGCCTGCCTTTTGGCCGTGGT
>probe:Drosophila_2:1627051_at:661:581; Interrogation_Position=44; Antisense; TGGCCGTGGTCTTCGCCAACGAGGA
>probe:Drosophila_2:1627051_at:209:285; Interrogation_Position=71; Antisense; CTGATGTTGTAAAGAGCGACTCCGA
>probe:Drosophila_2:1627051_at:163:325; Interrogation_Position=86; Antisense; GCGACTCCGAGGTTAACTTGCTGGA
>probe:Drosophila_2:1627051_at:442:659; Interrogation_Position=99; Antisense; TAACTTGCTGGACTTTAACTACGCT

Paste this into a BLAST search page for me
GGACTTTAACTACGCTTATGAGCTAATGAGCTATCCAACCATATTCGCGCATATTCGCGCCGTGCAAACTGGAGCGAAGTTTGTGATCGTTCTTGCCTGCGGAGCCTTGAAGGAGCACGACAACTAGCACGACAACTGGGTGGTTTCCGGAAAGTGGTCTACACCGCCGATGAAAGATGAAACCGGCTACCACCCAAAGGGGCTACCACCCAAAGGTCGTCGAGGTTCTTGCCTGCCTTTTGGCCGTGGTTGGCCGTGGTCTTCGCCAACGAGGACTGATGTTGTAAAGAGCGACTCCGAGCGACTCCGAGGTTAACTTGCTGGATAACTTGCTGGACTTTAACTACGCT

Full Affymetrix probeset data:

Annotations for 1627051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720