Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627052_at:

>probe:Drosophila_2:1627052_at:320:373; Interrogation_Position=1119; Antisense; GAAGTGATCGATGCGGCCGCACATC
>probe:Drosophila_2:1627052_at:343:357; Interrogation_Position=1137; Antisense; GCACATCTGAAGCTGCTCGGCGAGA
>probe:Drosophila_2:1627052_at:131:305; Interrogation_Position=1163; Antisense; CCTGACTGTGATTGGCGAGCGACTG
>probe:Drosophila_2:1627052_at:501:249; Interrogation_Position=1196; Antisense; CAATGGATACGTGGCGCTATCGGGC
>probe:Drosophila_2:1627052_at:351:335; Interrogation_Position=1265; Antisense; GCTGCTCTGCATGACCACGCAAATA
>probe:Drosophila_2:1627052_at:572:357; Interrogation_Position=1283; Antisense; GCAAATACCCGGCATGGAGAACAAT
>probe:Drosophila_2:1627052_at:546:725; Interrogation_Position=1314; Antisense; TTGAGCAAAAATCTGGCCGACACGC
>probe:Drosophila_2:1627052_at:385:335; Interrogation_Position=1337; Antisense; GCTCGACAACATCGCCTACGTAATG
>probe:Drosophila_2:1627052_at:572:139; Interrogation_Position=1354; Antisense; ACGTAATGCCCGGACTATGAAGTAA
>probe:Drosophila_2:1627052_at:404:489; Interrogation_Position=1375; Antisense; GTAAATTCCGGATTGCAACTGCAAA
>probe:Drosophila_2:1627052_at:644:687; Interrogation_Position=1418; Antisense; TATATAATCATACCAGGCCGCTGCG
>probe:Drosophila_2:1627052_at:431:147; Interrogation_Position=1455; Antisense; ACTAGAGTCGCCATCGGGATCTGTA
>probe:Drosophila_2:1627052_at:154:551; Interrogation_Position=1489; Antisense; GGAGTTGGCCAACCTGGAAATAGTT
>probe:Drosophila_2:1627052_at:189:345; Interrogation_Position=1548; Antisense; GCATCTAGATCCACAAATCATCGAA

Paste this into a BLAST search page for me
GAAGTGATCGATGCGGCCGCACATCGCACATCTGAAGCTGCTCGGCGAGACCTGACTGTGATTGGCGAGCGACTGCAATGGATACGTGGCGCTATCGGGCGCTGCTCTGCATGACCACGCAAATAGCAAATACCCGGCATGGAGAACAATTTGAGCAAAAATCTGGCCGACACGCGCTCGACAACATCGCCTACGTAATGACGTAATGCCCGGACTATGAAGTAAGTAAATTCCGGATTGCAACTGCAAATATATAATCATACCAGGCCGCTGCGACTAGAGTCGCCATCGGGATCTGTAGGAGTTGGCCAACCTGGAAATAGTTGCATCTAGATCCACAAATCATCGAA

Full Affymetrix probeset data:

Annotations for 1627052_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime