Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627053_at:

>probe:Drosophila_2:1627053_at:134:681; Interrogation_Position=1773; Antisense; TATGTAGCTCATAAGTATTCACTGT
>probe:Drosophila_2:1627053_at:230:711; Interrogation_Position=1790; Antisense; TTCACTGTACATAGATATAGCCGCG
>probe:Drosophila_2:1627053_at:127:687; Interrogation_Position=1805; Antisense; TATAGCCGCGACTGAGGCGCTAGAC
>probe:Drosophila_2:1627053_at:395:71; Interrogation_Position=1819; Antisense; AGGCGCTAGACGCTTGTAAATAGTT
>probe:Drosophila_2:1627053_at:162:663; Interrogation_Position=1882; Antisense; TAAAACCATATTCGGTTGACCGGAT
>probe:Drosophila_2:1627053_at:691:173; Interrogation_Position=1913; Antisense; AAAGCCTTTGCAGAGTTTGTGAAAA
>probe:Drosophila_2:1627053_at:164:261; Interrogation_Position=1966; Antisense; CATCCCTACTCTTTCGTCTAAATGA
>probe:Drosophila_2:1627053_at:307:555; Interrogation_Position=2007; Antisense; GGAACTTCCTCGATATATAACTAAC
>probe:Drosophila_2:1627053_at:236:185; Interrogation_Position=2073; Antisense; AACCCCGTCCAATATCGAACTATAG
>probe:Drosophila_2:1627053_at:556:145; Interrogation_Position=2147; Antisense; ACTTTGCAAAGGCTTTTACCAGCGA
>probe:Drosophila_2:1627053_at:308:695; Interrogation_Position=2161; Antisense; TTTACCAGCGAGTGTTTCAGAGTTG
>probe:Drosophila_2:1627053_at:152:493; Interrogation_Position=2186; Antisense; GTAACTTGTTGTCACATATCCGCGA
>probe:Drosophila_2:1627053_at:524:659; Interrogation_Position=2226; Antisense; TAACGATACTTAAGCGCTGCAGCAA
>probe:Drosophila_2:1627053_at:142:481; Interrogation_Position=2283; Antisense; GTATATTTAGACACCGAACGGAGCG

Paste this into a BLAST search page for me
TATGTAGCTCATAAGTATTCACTGTTTCACTGTACATAGATATAGCCGCGTATAGCCGCGACTGAGGCGCTAGACAGGCGCTAGACGCTTGTAAATAGTTTAAAACCATATTCGGTTGACCGGATAAAGCCTTTGCAGAGTTTGTGAAAACATCCCTACTCTTTCGTCTAAATGAGGAACTTCCTCGATATATAACTAACAACCCCGTCCAATATCGAACTATAGACTTTGCAAAGGCTTTTACCAGCGATTTACCAGCGAGTGTTTCAGAGTTGGTAACTTGTTGTCACATATCCGCGATAACGATACTTAAGCGCTGCAGCAAGTATATTTAGACACCGAACGGAGCG

Full Affymetrix probeset data:

Annotations for 1627053_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime