Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627054_at:

>probe:Drosophila_2:1627054_at:424:437; Interrogation_Position=5621; Antisense; GAGGAGCTTCAGATTTCCAATGGAG
>probe:Drosophila_2:1627054_at:606:585; Interrogation_Position=5641; Antisense; TGGAGTTTAGCTAACAACGACTGTT
>probe:Drosophila_2:1627054_at:347:183; Interrogation_Position=5683; Antisense; AAAAGTGGAAGGGACGTCGAGCAAT
>probe:Drosophila_2:1627054_at:593:419; Interrogation_Position=5701; Antisense; GAGCAATGGAAAACTAACCCCAACA
>probe:Drosophila_2:1627054_at:216:159; Interrogation_Position=5723; Antisense; ACAAATGTAACAACAGCAGCATCCA
>probe:Drosophila_2:1627054_at:141:37; Interrogation_Position=5804; Antisense; ATCATCTATTCTATCTTTGTATCTG
>probe:Drosophila_2:1627054_at:47:485; Interrogation_Position=5822; Antisense; GTATCTGTATGTTATTCTACTGTAC
>probe:Drosophila_2:1627054_at:552:643; Interrogation_Position=5837; Antisense; TCTACTGTACGTTTATCCAATTCTC
>probe:Drosophila_2:1627054_at:24:683; Interrogation_Position=5850; Antisense; TATCCAATTCTCTATGTCCACAAAA
>probe:Drosophila_2:1627054_at:110:25; Interrogation_Position=5904; Antisense; ATAGGTCAACTTTCAAGCGAGCAAC
>probe:Drosophila_2:1627054_at:242:421; Interrogation_Position=5922; Antisense; GAGCAACAAGTATTCAAGCTTAGTT
>probe:Drosophila_2:1627054_at:336:333; Interrogation_Position=5939; Antisense; GCTTAGTTGCTTCTTTTTTCGTTTG
>probe:Drosophila_2:1627054_at:569:395; Interrogation_Position=5977; Antisense; GAAATTGTTTTCAGCTTACATACAT
>probe:Drosophila_2:1627054_at:36:133; Interrogation_Position=6160; Antisense; ACCCATAAGTCGTTATTTGTGCAAC

Paste this into a BLAST search page for me
GAGGAGCTTCAGATTTCCAATGGAGTGGAGTTTAGCTAACAACGACTGTTAAAAGTGGAAGGGACGTCGAGCAATGAGCAATGGAAAACTAACCCCAACAACAAATGTAACAACAGCAGCATCCAATCATCTATTCTATCTTTGTATCTGGTATCTGTATGTTATTCTACTGTACTCTACTGTACGTTTATCCAATTCTCTATCCAATTCTCTATGTCCACAAAAATAGGTCAACTTTCAAGCGAGCAACGAGCAACAAGTATTCAAGCTTAGTTGCTTAGTTGCTTCTTTTTTCGTTTGGAAATTGTTTTCAGCTTACATACATACCCATAAGTCGTTATTTGTGCAAC

Full Affymetrix probeset data:

Annotations for 1627054_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime