FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627055_at:

>probe:Drosophila_2:1627055_at:460:211; Interrogation_Position=147; Antisense; AAGAAGCACACGCTGGACAGCCTGT
>probe:Drosophila_2:1627055_at:673:399; Interrogation_Position=162; Antisense; GACAGCCTGTTCTTGGTGTATTCCA
>probe:Drosophila_2:1627055_at:14:535; Interrogation_Position=176; Antisense; GGTGTATTCCAACTTCCAGGTCATA
>probe:Drosophila_2:1627055_at:634:27; Interrogation_Position=198; Antisense; ATACCCACCGACATCGAGAACGAGT
>probe:Drosophila_2:1627055_at:691:89; Interrogation_Position=220; Antisense; AGTACTTTGACAGCATACTCCTCTC
>probe:Drosophila_2:1627055_at:522:643; Interrogation_Position=241; Antisense; TCTCGCAGTTGGACGCCTGGCTAGA
>probe:Drosophila_2:1627055_at:548:365; Interrogation_Position=28; Antisense; GAATACTGCTCTTTATCTGCCAGGG
>probe:Drosophila_2:1627055_at:68:651; Interrogation_Position=292; Antisense; TAACTCGAACTCAGACCGGTTTAAT
>probe:Drosophila_2:1627055_at:548:373; Interrogation_Position=351; Antisense; GAAGACTTTCTCGAGGTCCTAAATA
>probe:Drosophila_2:1627055_at:613:529; Interrogation_Position=365; Antisense; GGTCCTAAATAACTTGGCATCCGAT
>probe:Drosophila_2:1627055_at:179:585; Interrogation_Position=379; Antisense; TGGCATCCGATAACAATCTGGCTAT
>probe:Drosophila_2:1627055_at:469:239; Interrogation_Position=419; Antisense; AATAATGATCGATGCTGGCGTCCCG
>probe:Drosophila_2:1627055_at:302:291; Interrogation_Position=437; Antisense; CGTCCCGAATGGTGCTGATGTAGTT
>probe:Drosophila_2:1627055_at:218:561; Interrogation_Position=52; Antisense; GGAAACCATTCTCGTTTGTACAAAT

Paste this into a BLAST search page for me
AAGAAGCACACGCTGGACAGCCTGTGACAGCCTGTTCTTGGTGTATTCCAGGTGTATTCCAACTTCCAGGTCATAATACCCACCGACATCGAGAACGAGTAGTACTTTGACAGCATACTCCTCTCTCTCGCAGTTGGACGCCTGGCTAGAGAATACTGCTCTTTATCTGCCAGGGTAACTCGAACTCAGACCGGTTTAATGAAGACTTTCTCGAGGTCCTAAATAGGTCCTAAATAACTTGGCATCCGATTGGCATCCGATAACAATCTGGCTATAATAATGATCGATGCTGGCGTCCCGCGTCCCGAATGGTGCTGATGTAGTTGGAAACCATTCTCGTTTGTACAAAT

Full Affymetrix probeset data:

Annotations for 1627055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720