Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627056_a_at:

>probe:Drosophila_2:1627056_a_at:543:315; Interrogation_Position=435; Antisense; GCCTCCATAATTTCACCCAAAGCAA
>probe:Drosophila_2:1627056_a_at:139:555; Interrogation_Position=569; Antisense; GGACGAAATCGCCTCGAACGACTCA
>probe:Drosophila_2:1627056_a_at:268:281; Interrogation_Position=581; Antisense; CTCGAACGACTCAATCCTGGATGAT
>probe:Drosophila_2:1627056_a_at:312:145; Interrogation_Position=608; Antisense; ACTCAGAACAGATCAGCCCTATCAA
>probe:Drosophila_2:1627056_a_at:301:199; Interrogation_Position=654; Antisense; AACGAGTTCCTCGAAGTACAACAGA
>probe:Drosophila_2:1627056_a_at:561:367; Interrogation_Position=677; Antisense; GAATGAAACAGATCTCCAGGACCAA
>probe:Drosophila_2:1627056_a_at:618:213; Interrogation_Position=718; Antisense; AAGAGATGATACAGCTCAAGCCGGA
>probe:Drosophila_2:1627056_a_at:73:199; Interrogation_Position=759; Antisense; AACGAATACCAAGTCGACGCGATGA
>probe:Drosophila_2:1627056_a_at:328:411; Interrogation_Position=774; Antisense; GACGCGATGACGGAAGACACCATTA
>probe:Drosophila_2:1627056_a_at:718:429; Interrogation_Position=824; Antisense; GAGTTTGGCTCTGCAGCTGAACAAC
>probe:Drosophila_2:1627056_a_at:100:657; Interrogation_Position=868; Antisense; TAATGTGCCAGGAGCGTCTGCAGGT
>probe:Drosophila_2:1627056_a_at:705:517; Interrogation_Position=891; Antisense; GTGGTCCTAACGGAATTTCGCCTGA
>probe:Drosophila_2:1627056_a_at:101:19; Interrogation_Position=905; Antisense; ATTTCGCCTGAAGGTGCTCAAGCGC
>probe:Drosophila_2:1627056_a_at:694:419; Interrogation_Position=936; Antisense; GAGCAAGCACGATCTTCGTAGGCTT

Paste this into a BLAST search page for me
GCCTCCATAATTTCACCCAAAGCAAGGACGAAATCGCCTCGAACGACTCACTCGAACGACTCAATCCTGGATGATACTCAGAACAGATCAGCCCTATCAAAACGAGTTCCTCGAAGTACAACAGAGAATGAAACAGATCTCCAGGACCAAAAGAGATGATACAGCTCAAGCCGGAAACGAATACCAAGTCGACGCGATGAGACGCGATGACGGAAGACACCATTAGAGTTTGGCTCTGCAGCTGAACAACTAATGTGCCAGGAGCGTCTGCAGGTGTGGTCCTAACGGAATTTCGCCTGAATTTCGCCTGAAGGTGCTCAAGCGCGAGCAAGCACGATCTTCGTAGGCTT

Full Affymetrix probeset data:

Annotations for 1627056_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime