Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627058_at:

>probe:Drosophila_2:1627058_at:404:87; Interrogation_Position=1721; Antisense; AGTGCCTCCAGCAGAGACATCACAG
>probe:Drosophila_2:1627058_at:504:101; Interrogation_Position=1733; Antisense; AGAGACATCACAGCCGGCACTTGCA
>probe:Drosophila_2:1627058_at:73:151; Interrogation_Position=1751; Antisense; ACTTGCAGTGATTCCGGTGTTCGAG
>probe:Drosophila_2:1627058_at:644:365; Interrogation_Position=1806; Antisense; GAATCGCCTGAGAAGAAGTCCCGAC
>probe:Drosophila_2:1627058_at:341:353; Interrogation_Position=1873; Antisense; GCAGCTCCAGCCAATTTAATCTAAC
>probe:Drosophila_2:1627058_at:382:209; Interrogation_Position=1917; Antisense; AAGCAAGCTACTCCCATTGCAGTGA
>probe:Drosophila_2:1627058_at:269:131; Interrogation_Position=1952; Antisense; ACGCGTACTCATCGAAATGCCGGTG
>probe:Drosophila_2:1627058_at:450:393; Interrogation_Position=1965; Antisense; GAAATGCCGGTGAACTCGCCTGTGG
>probe:Drosophila_2:1627058_at:198:145; Interrogation_Position=1978; Antisense; ACTCGCCTGTGGTCCCAATGGAGGA
>probe:Drosophila_2:1627058_at:185:633; Interrogation_Position=2066; Antisense; TCGAAAACCCTTGCCGGAGACTGTA
>probe:Drosophila_2:1627058_at:320:655; Interrogation_Position=2113; Antisense; TAATAGAGGCCAGCGAGGCCACCTG
>probe:Drosophila_2:1627058_at:668:309; Interrogation_Position=2131; Antisense; CCACCTGCGAGCGAACTGAGGACAT
>probe:Drosophila_2:1627058_at:438:557; Interrogation_Position=2150; Antisense; GGACATTCGTCTGGTCTACGAGGAT
>probe:Drosophila_2:1627058_at:157:31; Interrogation_Position=2227; Antisense; ATAACAAGACGCCACGTCGCGTGTC

Paste this into a BLAST search page for me
AGTGCCTCCAGCAGAGACATCACAGAGAGACATCACAGCCGGCACTTGCAACTTGCAGTGATTCCGGTGTTCGAGGAATCGCCTGAGAAGAAGTCCCGACGCAGCTCCAGCCAATTTAATCTAACAAGCAAGCTACTCCCATTGCAGTGAACGCGTACTCATCGAAATGCCGGTGGAAATGCCGGTGAACTCGCCTGTGGACTCGCCTGTGGTCCCAATGGAGGATCGAAAACCCTTGCCGGAGACTGTATAATAGAGGCCAGCGAGGCCACCTGCCACCTGCGAGCGAACTGAGGACATGGACATTCGTCTGGTCTACGAGGATATAACAAGACGCCACGTCGCGTGTC

Full Affymetrix probeset data:

Annotations for 1627058_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime