Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627059_at:

>probe:Drosophila_2:1627059_at:249:169; Interrogation_Position=1248; Antisense; AAAGGCGGAGAGTCCACTCGCATGG
>probe:Drosophila_2:1627059_at:585:245; Interrogation_Position=1282; Antisense; AATTCTACGCCATTGAGACGTTCGG
>probe:Drosophila_2:1627059_at:37:503; Interrogation_Position=1315; Antisense; GTCGCGGTCTGGTCCATGACGATAT
>probe:Drosophila_2:1627059_at:266:409; Interrogation_Position=1332; Antisense; GACGATATGGACTGCTCGCATTACA
>probe:Drosophila_2:1627059_at:579:105; Interrogation_Position=1360; Antisense; AGAACTTTGATCTGCCGTTTGTGCC
>probe:Drosophila_2:1627059_at:237:31; Interrogation_Position=1422; Antisense; ATCAACAAAAACTTCGGCACCCTGG
>probe:Drosophila_2:1627059_at:12:705; Interrogation_Position=1535; Antisense; TTATCCGCCGTTGTGCGACATTAAG
>probe:Drosophila_2:1627059_at:275:151; Interrogation_Position=1552; Antisense; ACATTAAGGGCTGCTACACGGCTCA
>probe:Drosophila_2:1627059_at:536:157; Interrogation_Position=1567; Antisense; ACACGGCTCAGTACGAACACACAAT
>probe:Drosophila_2:1627059_at:161:387; Interrogation_Position=1581; Antisense; GAACACACAATTATGCTGCGACCCA
>probe:Drosophila_2:1627059_at:522:251; Interrogation_Position=1607; Antisense; CTGCAAAGAAGTCGTTTCCCGTGGC
>probe:Drosophila_2:1627059_at:165:197; Interrogation_Position=1654; Antisense; AACTGGACAGTGACCGATTTTCGGC
>probe:Drosophila_2:1627059_at:272:461; Interrogation_Position=1669; Antisense; GATTTTCGGCGATGTATGGCTTGCA
>probe:Drosophila_2:1627059_at:386:15; Interrogation_Position=1732; Antisense; ATTTTTTGTGAGCATGCGCCAACCG

Paste this into a BLAST search page for me
AAAGGCGGAGAGTCCACTCGCATGGAATTCTACGCCATTGAGACGTTCGGGTCGCGGTCTGGTCCATGACGATATGACGATATGGACTGCTCGCATTACAAGAACTTTGATCTGCCGTTTGTGCCATCAACAAAAACTTCGGCACCCTGGTTATCCGCCGTTGTGCGACATTAAGACATTAAGGGCTGCTACACGGCTCAACACGGCTCAGTACGAACACACAATGAACACACAATTATGCTGCGACCCACTGCAAAGAAGTCGTTTCCCGTGGCAACTGGACAGTGACCGATTTTCGGCGATTTTCGGCGATGTATGGCTTGCAATTTTTTGTGAGCATGCGCCAACCG

Full Affymetrix probeset data:

Annotations for 1627059_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime