Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627062_s_at:

>probe:Drosophila_2:1627062_s_at:99:717; Interrogation_Position=190; Antisense; TTCGACATGCTGTTCCACAAGGGCG
>probe:Drosophila_2:1627062_s_at:83:383; Interrogation_Position=264; Antisense; GAACGAGGGAGCCACCAATGCGCTA
>probe:Drosophila_2:1627062_s_at:573:233; Interrogation_Position=280; Antisense; AATGCGCTACTGAAACTGGACGGAA
>probe:Drosophila_2:1627062_s_at:68:395; Interrogation_Position=314; Antisense; GAAATCGCTCGATAGCCGTGCGTTT
>probe:Drosophila_2:1627062_s_at:602:21; Interrogation_Position=389; Antisense; ATATACCGGCCTTGGGCACAGGTAA
>probe:Drosophila_2:1627062_s_at:655:175; Interrogation_Position=434; Antisense; AAACGGAGGCCATTCGGGCCATTGA
>probe:Drosophila_2:1627062_s_at:639:465; Interrogation_Position=474; Antisense; GTTGGAGCGCCAGACAGACGACAAT
>probe:Drosophila_2:1627062_s_at:693:647; Interrogation_Position=542; Antisense; TCATCCAGCGCTATCAGTTTAACAA
>probe:Drosophila_2:1627062_s_at:452:693; Interrogation_Position=559; Antisense; TTTAACAAGGATCGCGACGGTTCGC
>probe:Drosophila_2:1627062_s_at:727:539; Interrogation_Position=577; Antisense; GGTTCGCAGCGCTACGGAAAGTCAT
>probe:Drosophila_2:1627062_s_at:483:393; Interrogation_Position=593; Antisense; GAAAGTCATCGGCTCCATATCATCA
>probe:Drosophila_2:1627062_s_at:676:131; Interrogation_Position=671; Antisense; ACCGTCTCACGCATTAGTCTGTAAA
>probe:Drosophila_2:1627062_s_at:208:705; Interrogation_Position=708; Antisense; TTAGGGCGCTACCTCAGCAGACGAG
>probe:Drosophila_2:1627062_s_at:121:113; Interrogation_Position=723; Antisense; AGCAGACGAGCCTTGCAGGTGTAAT

Paste this into a BLAST search page for me
TTCGACATGCTGTTCCACAAGGGCGGAACGAGGGAGCCACCAATGCGCTAAATGCGCTACTGAAACTGGACGGAAGAAATCGCTCGATAGCCGTGCGTTTATATACCGGCCTTGGGCACAGGTAAAAACGGAGGCCATTCGGGCCATTGAGTTGGAGCGCCAGACAGACGACAATTCATCCAGCGCTATCAGTTTAACAATTTAACAAGGATCGCGACGGTTCGCGGTTCGCAGCGCTACGGAAAGTCATGAAAGTCATCGGCTCCATATCATCAACCGTCTCACGCATTAGTCTGTAAATTAGGGCGCTACCTCAGCAGACGAGAGCAGACGAGCCTTGCAGGTGTAAT

Full Affymetrix probeset data:

Annotations for 1627062_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime