Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627064_at:

>probe:Drosophila_2:1627064_at:127:409; Interrogation_Position=1709; Antisense; GACGTCAAAAAACCAGAGCGCTTCC
>probe:Drosophila_2:1627064_at:581:347; Interrogation_Position=1744; Antisense; GCAGGCTCCGATGCAAACCGAGGAT
>probe:Drosophila_2:1627064_at:670:191; Interrogation_Position=1778; Antisense; AACTTTGTGGTCGAGGCACAGCCGG
>probe:Drosophila_2:1627064_at:715:539; Interrogation_Position=1801; Antisense; GGATACTCCCAGCTAAACACACTAC
>probe:Drosophila_2:1627064_at:105:279; Interrogation_Position=1826; Antisense; CTACTGGCCCTTTGGAATACTGAAA
>probe:Drosophila_2:1627064_at:441:365; Interrogation_Position=1840; Antisense; GAATACTGAAATAAAGCCTCGCTCT
>probe:Drosophila_2:1627064_at:181:307; Interrogation_Position=1856; Antisense; CCTCGCTCTTATTTATGGCTCAATT
>probe:Drosophila_2:1627064_at:429:269; Interrogation_Position=1892; Antisense; CATGTGCATTGGGAGTTTGCCGGCA
>probe:Drosophila_2:1627064_at:229:199; Interrogation_Position=1926; Antisense; AACGAAGTTTCTTGTGGCTGCTACC
>probe:Drosophila_2:1627064_at:616:521; Interrogation_Position=1939; Antisense; GTGGCTGCTACCTTGTAGAGCTCTT
>probe:Drosophila_2:1627064_at:388:677; Interrogation_Position=1954; Antisense; TAGAGCTCTTTTGGTACTTACGCGA
>probe:Drosophila_2:1627064_at:577:707; Interrogation_Position=2021; Antisense; TTCAAGTTTCCAGTGGCACGTTCCA
>probe:Drosophila_2:1627064_at:340:291; Interrogation_Position=2039; Antisense; CGTTCCACAGGAAGTCAGCCGTAAA
>probe:Drosophila_2:1627064_at:480:567; Interrogation_Position=2152; Antisense; TGTTTGCTTTTTCTAAAGGGCCTGT

Paste this into a BLAST search page for me
GACGTCAAAAAACCAGAGCGCTTCCGCAGGCTCCGATGCAAACCGAGGATAACTTTGTGGTCGAGGCACAGCCGGGGATACTCCCAGCTAAACACACTACCTACTGGCCCTTTGGAATACTGAAAGAATACTGAAATAAAGCCTCGCTCTCCTCGCTCTTATTTATGGCTCAATTCATGTGCATTGGGAGTTTGCCGGCAAACGAAGTTTCTTGTGGCTGCTACCGTGGCTGCTACCTTGTAGAGCTCTTTAGAGCTCTTTTGGTACTTACGCGATTCAAGTTTCCAGTGGCACGTTCCACGTTCCACAGGAAGTCAGCCGTAAATGTTTGCTTTTTCTAAAGGGCCTGT

Full Affymetrix probeset data:

Annotations for 1627064_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime