FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627067_at:

>probe:Drosophila_2:1627067_at:181:221; Interrogation_Position=1043; Antisense; AAGTGGAATAATGCGCCTCCTACTT
>probe:Drosophila_2:1627067_at:626:299; Interrogation_Position=1056; Antisense; CGCCTCCTACTTACTTCTTAAATAT
>probe:Drosophila_2:1627067_at:230:19; Interrogation_Position=585; Antisense; ATTTCCAATGGCGAACTGTTTCAGG
>probe:Drosophila_2:1627067_at:608:31; Interrogation_Position=631; Antisense; ATAATCTGAAGGACACGCAACTGCA
>probe:Drosophila_2:1627067_at:654:451; Interrogation_Position=707; Antisense; GATCTCGTTCGATGAGTTCTGCTCT
>probe:Drosophila_2:1627067_at:221:519; Interrogation_Position=732; Antisense; GTGGTCGGCAACACGGACATTCACA
>probe:Drosophila_2:1627067_at:318:537; Interrogation_Position=784; Antisense; GGTTTAACGCAGATCCTTTTCTACG
>probe:Drosophila_2:1627067_at:65:443; Interrogation_Position=795; Antisense; GATCCTTTTCTACGCGATGTTATTT
>probe:Drosophila_2:1627067_at:243:17; Interrogation_Position=824; Antisense; ATTTTATACACGTCGGCATCCTTCG
>probe:Drosophila_2:1627067_at:75:639; Interrogation_Position=846; Antisense; TCGATTGTCACTATCACCACTATTC
>probe:Drosophila_2:1627067_at:667:725; Interrogation_Position=886; Antisense; TTGATCGGCGATTCTCTATAGTTAA
>probe:Drosophila_2:1627067_at:93:473; Interrogation_Position=916; Antisense; GTTATGAGCCTTTGGCGAGCCAGTT
>probe:Drosophila_2:1627067_at:357:319; Interrogation_Position=930; Antisense; GCGAGCCAGTTCAGTTAGTCAGTCA
>probe:Drosophila_2:1627067_at:724:313; Interrogation_Position=971; Antisense; GCCAGTCAGTCAGTACAGCGATCGA

Paste this into a BLAST search page for me
AAGTGGAATAATGCGCCTCCTACTTCGCCTCCTACTTACTTCTTAAATATATTTCCAATGGCGAACTGTTTCAGGATAATCTGAAGGACACGCAACTGCAGATCTCGTTCGATGAGTTCTGCTCTGTGGTCGGCAACACGGACATTCACAGGTTTAACGCAGATCCTTTTCTACGGATCCTTTTCTACGCGATGTTATTTATTTTATACACGTCGGCATCCTTCGTCGATTGTCACTATCACCACTATTCTTGATCGGCGATTCTCTATAGTTAAGTTATGAGCCTTTGGCGAGCCAGTTGCGAGCCAGTTCAGTTAGTCAGTCAGCCAGTCAGTCAGTACAGCGATCGA

Full Affymetrix probeset data:

Annotations for 1627067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720