FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627068_at:

>probe:Drosophila_2:1627068_at:581:109; Interrogation_Position=1013; Antisense; AGAATCCCGAGTGCCAGGATCGCTG
>probe:Drosophila_2:1627068_at:11:419; Interrogation_Position=1045; Antisense; GAGCTGGCGACCATATTCGAGGACA
>probe:Drosophila_2:1627068_at:99:401; Interrogation_Position=1066; Antisense; GACAGTAATAGAGCTCCCACGATGA
>probe:Drosophila_2:1627068_at:80:401; Interrogation_Position=1157; Antisense; TCCCGCTTATTGCTCGTAAACTGGG
>probe:Drosophila_2:1627068_at:42:541; Interrogation_Position=1188; Antisense; GGTTCGCCTGGCAAAGCACACATTG
>probe:Drosophila_2:1627068_at:495:109; Interrogation_Position=1222; Antisense; AGCAACGTTTTCATTTGCCCCTATG
>probe:Drosophila_2:1627068_at:376:459; Interrogation_Position=1301; Antisense; GATTTTCGCCCGAGAACTCCGAGAA
>probe:Drosophila_2:1627068_at:679:123; Interrogation_Position=1354; Antisense; AGCGCTGGACCGAGATATTGCATTG
>probe:Drosophila_2:1627068_at:527:453; Interrogation_Position=1401; Antisense; GATCAAGACCATAGTGTCGCGCCTG
>probe:Drosophila_2:1627068_at:215:261; Interrogation_Position=1438; Antisense; CAGCTGCTTCCTGTAACCGGAAAGA
>probe:Drosophila_2:1627068_at:621:559; Interrogation_Position=1456; Antisense; GGAAAGACAACCATTGCGGCCACCT
>probe:Drosophila_2:1627068_at:413:311; Interrogation_Position=1474; Antisense; GCCACCTTCCGGATTACGCTGAGAG
>probe:Drosophila_2:1627068_at:512:653; Interrogation_Position=1523; Antisense; TCAAGGAGCGCGATCATCCGCTAAT
>probe:Drosophila_2:1627068_at:719:697; Interrogation_Position=990; Antisense; TTTCACTCTCTTTCTGCTGACACAG

Paste this into a BLAST search page for me
AGAATCCCGAGTGCCAGGATCGCTGGAGCTGGCGACCATATTCGAGGACAGACAGTAATAGAGCTCCCACGATGATCCCGCTTATTGCTCGTAAACTGGGGGTTCGCCTGGCAAAGCACACATTGAGCAACGTTTTCATTTGCCCCTATGGATTTTCGCCCGAGAACTCCGAGAAAGCGCTGGACCGAGATATTGCATTGGATCAAGACCATAGTGTCGCGCCTGCAGCTGCTTCCTGTAACCGGAAAGAGGAAAGACAACCATTGCGGCCACCTGCCACCTTCCGGATTACGCTGAGAGTCAAGGAGCGCGATCATCCGCTAATTTTCACTCTCTTTCTGCTGACACAG

Full Affymetrix probeset data:

Annotations for 1627068_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720