FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627069_at:

>probe:Drosophila_2:1627069_at:342:399; Interrogation_Position=1023; Antisense; GACACGACACTGACAGACACATATG
>probe:Drosophila_2:1627069_at:372:667; Interrogation_Position=1066; Antisense; TACATTGCTGACAAAGTCGAGCGCT
>probe:Drosophila_2:1627069_at:208:501; Interrogation_Position=1081; Antisense; GTCGAGCGCTAAACTGGAGAACAAC
>probe:Drosophila_2:1627069_at:259:667; Interrogation_Position=1187; Antisense; TACTTCGTTATCTCACTAGGGCTAG
>probe:Drosophila_2:1627069_at:49:517; Interrogation_Position=1205; Antisense; GGGCTAGAGACCCTTGTAAGCCTCC
>probe:Drosophila_2:1627069_at:79:123; Interrogation_Position=1223; Antisense; AGCCTCCCCTAATTCCAATTGTAGA
>probe:Drosophila_2:1627069_at:246:159; Interrogation_Position=1298; Antisense; ACAAAGTTATAGTAGCTCGCTCCCT
>probe:Drosophila_2:1627069_at:57:283; Interrogation_Position=1313; Antisense; CTCGCTCCCTTTTGTTAATTTCATT
>probe:Drosophila_2:1627069_at:130:655; Interrogation_Position=1328; Antisense; TAATTTCATTGTGGTCGTCGCGTGT
>probe:Drosophila_2:1627069_at:408:639; Interrogation_Position=1342; Antisense; TCGTCGCGTGTGCTAATCCAAACAA
>probe:Drosophila_2:1627069_at:49:181; Interrogation_Position=1371; Antisense; AAAACGTTGCCATATCACTCTAAAG
>probe:Drosophila_2:1627069_at:394:663; Interrogation_Position=1391; Antisense; TAAAGTCTCGTAACGTCTTCTCGGT
>probe:Drosophila_2:1627069_at:304:497; Interrogation_Position=1405; Antisense; GTCTTCTCGGTCCATTACACTATTA
>probe:Drosophila_2:1627069_at:23:237; Interrogation_Position=1454; Antisense; AATCCCCAACGCTAAATCAGTGTGT

Paste this into a BLAST search page for me
GACACGACACTGACAGACACATATGTACATTGCTGACAAAGTCGAGCGCTGTCGAGCGCTAAACTGGAGAACAACTACTTCGTTATCTCACTAGGGCTAGGGGCTAGAGACCCTTGTAAGCCTCCAGCCTCCCCTAATTCCAATTGTAGAACAAAGTTATAGTAGCTCGCTCCCTCTCGCTCCCTTTTGTTAATTTCATTTAATTTCATTGTGGTCGTCGCGTGTTCGTCGCGTGTGCTAATCCAAACAAAAAACGTTGCCATATCACTCTAAAGTAAAGTCTCGTAACGTCTTCTCGGTGTCTTCTCGGTCCATTACACTATTAAATCCCCAACGCTAAATCAGTGTGT

Full Affymetrix probeset data:

Annotations for 1627069_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720