Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627071_at:

>probe:Drosophila_2:1627071_at:293:237; Interrogation_Position=100; Antisense; AATCTGCTGCCCTACTTCGACTTTG
>probe:Drosophila_2:1627071_at:55:337; Interrogation_Position=105; Antisense; GCTGCCCTACTTCGACTTTGATGTG
>probe:Drosophila_2:1627071_at:470:667; Interrogation_Position=112; Antisense; TACTTCGACTTTGATGTGCCGCGCA
>probe:Drosophila_2:1627071_at:679:635; Interrogation_Position=116; Antisense; TCGACTTTGATGTGCCGCGCAACTT
>probe:Drosophila_2:1627071_at:267:443; Interrogation_Position=124; Antisense; GATGTGCCGCGCAACTTGACCGTAA
>probe:Drosophila_2:1627071_at:648:357; Interrogation_Position=134; Antisense; GCAACTTGACCGTAACCGTTGGCCA
>probe:Drosophila_2:1627071_at:168:721; Interrogation_Position=139; Antisense; TTGACCGTAACCGTTGGCCAGACCG
>probe:Drosophila_2:1627071_at:169:269; Interrogation_Position=146; Antisense; TAACCGTTGGCCAGACCGGCTTTCT
>probe:Drosophila_2:1627071_at:572:579; Interrogation_Position=153; Antisense; TGGCCAGACCGGCTTTCTCCATTGC
>probe:Drosophila_2:1627071_at:610:591; Interrogation_Position=170; Antisense; TCCATTGCCGCGTGGAACGACTCGG
>probe:Drosophila_2:1627071_at:422:303; Interrogation_Position=177; Antisense; CCGCGTGGAACGACTCGGCGATAAG
>probe:Drosophila_2:1627071_at:448:1; Interrogation_Position=186; Antisense; ACGACTCGGCGATAAGGACGTAAGT
>probe:Drosophila_2:1627071_at:276:327; Interrogation_Position=33; Antisense; GCGTTGCTACAACGCTGCGTTGGCA
>probe:Drosophila_2:1627071_at:596:159; Interrogation_Position=70; Antisense; ACAACGTCAACTACAACCATCTCGC

Paste this into a BLAST search page for me
AATCTGCTGCCCTACTTCGACTTTGGCTGCCCTACTTCGACTTTGATGTGTACTTCGACTTTGATGTGCCGCGCATCGACTTTGATGTGCCGCGCAACTTGATGTGCCGCGCAACTTGACCGTAAGCAACTTGACCGTAACCGTTGGCCATTGACCGTAACCGTTGGCCAGACCGTAACCGTTGGCCAGACCGGCTTTCTTGGCCAGACCGGCTTTCTCCATTGCTCCATTGCCGCGTGGAACGACTCGGCCGCGTGGAACGACTCGGCGATAAGACGACTCGGCGATAAGGACGTAAGTGCGTTGCTACAACGCTGCGTTGGCAACAACGTCAACTACAACCATCTCGC

Full Affymetrix probeset data:

Annotations for 1627071_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime