Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627073_a_at:

>probe:Drosophila_2:1627073_a_at:526:429; Interrogation_Position=253; Antisense; GAGTTCATCACTGGCATTAGGGACA
>probe:Drosophila_2:1627073_a_at:695:453; Interrogation_Position=303; Antisense; GATCAAGCAGATGTTCGCCACGTTT
>probe:Drosophila_2:1627073_a_at:262:443; Interrogation_Position=312; Antisense; GATGTTCGCCACGTTTGATGAGGAT
>probe:Drosophila_2:1627073_a_at:256:33; Interrogation_Position=355; Antisense; ATGACCGAGTTCCTGCTTAAACTAA
>probe:Drosophila_2:1627073_a_at:408:11; Interrogation_Position=538; Antisense; ATTCTTACCGACTTTTTGCACAACT
>probe:Drosophila_2:1627073_a_at:666:87; Interrogation_Position=593; Antisense; AGATAACCCGCGAGGAGTTTGTCAA
>probe:Drosophila_2:1627073_a_at:147:481; Interrogation_Position=609; Antisense; GTTTGTCAACTATTATGCCACCATT
>probe:Drosophila_2:1627073_a_at:349:261; Interrogation_Position=627; Antisense; CACCATTAGTGCCTCAATTGACAAC
>probe:Drosophila_2:1627073_a_at:630:605; Interrogation_Position=663; Antisense; TGATCTGATGATGCGACGTGCCTAC
>probe:Drosophila_2:1627073_a_at:632:139; Interrogation_Position=678; Antisense; ACGTGCCTACGTCATGTAACTAGTG
>probe:Drosophila_2:1627073_a_at:656:505; Interrogation_Position=700; Antisense; GTGCGCAAATCTCACTGAACATTTT
>probe:Drosophila_2:1627073_a_at:679:653; Interrogation_Position=729; Antisense; TCAATCACTTTACTTGCCTCGAATT
>probe:Drosophila_2:1627073_a_at:29:723; Interrogation_Position=742; Antisense; TTGCCTCGAATTTAGTCCTGCTCAT
>probe:Drosophila_2:1627073_a_at:317:631; Interrogation_Position=757; Antisense; TCCTGCTCATGTCCTATTTATACAC

Paste this into a BLAST search page for me
GAGTTCATCACTGGCATTAGGGACAGATCAAGCAGATGTTCGCCACGTTTGATGTTCGCCACGTTTGATGAGGATATGACCGAGTTCCTGCTTAAACTAAATTCTTACCGACTTTTTGCACAACTAGATAACCCGCGAGGAGTTTGTCAAGTTTGTCAACTATTATGCCACCATTCACCATTAGTGCCTCAATTGACAACTGATCTGATGATGCGACGTGCCTACACGTGCCTACGTCATGTAACTAGTGGTGCGCAAATCTCACTGAACATTTTTCAATCACTTTACTTGCCTCGAATTTTGCCTCGAATTTAGTCCTGCTCATTCCTGCTCATGTCCTATTTATACAC

Full Affymetrix probeset data:

Annotations for 1627073_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime