Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627074_at:

>probe:Drosophila_2:1627074_at:646:259; Interrogation_Position=4689; Antisense; CACCCGCGGCGGACTGGAAATGTTG
>probe:Drosophila_2:1627074_at:599:573; Interrogation_Position=4765; Antisense; GGCGTGTTCTCGGTGATCTGCATCT
>probe:Drosophila_2:1627074_at:523:451; Interrogation_Position=4779; Antisense; GATCTGCATCTTCACGGAGAACGAC
>probe:Drosophila_2:1627074_at:711:135; Interrogation_Position=4799; Antisense; ACGACGAGTACGTGGCTTATTACCA
>probe:Drosophila_2:1627074_at:168:343; Interrogation_Position=4813; Antisense; GCTTATTACCATAGCGGCCGCAAGA
>probe:Drosophila_2:1627074_at:144:213; Interrogation_Position=4834; Antisense; AAGACCATACGCGTATTTCGCACCG
>probe:Drosophila_2:1627074_at:20:719; Interrogation_Position=4850; Antisense; TTCGCACCGCGGACACTGAAATGAT
>probe:Drosophila_2:1627074_at:167:59; Interrogation_Position=4870; Antisense; ATGATAGCCAACTACCGGCTGCAGG
>probe:Drosophila_2:1627074_at:251:349; Interrogation_Position=4890; Antisense; GCAGGCTGAGCTTACGGCGATCAAA
>probe:Drosophila_2:1627074_at:562:65; Interrogation_Position=4925; Antisense; ATGGACGCGCTATAGTTTTGGGAAC
>probe:Drosophila_2:1627074_at:77:679; Interrogation_Position=4962; Antisense; TATGTCGGTGCTGGCGATCGTCGAT
>probe:Drosophila_2:1627074_at:466:369; Interrogation_Position=5004; Antisense; GAATGAGTACCTGAACGACCTGCCC
>probe:Drosophila_2:1627074_at:696:531; Interrogation_Position=5076; Antisense; GGTTGGTTTCAAGGCGGCAATTCGT
>probe:Drosophila_2:1627074_at:89:75; Interrogation_Position=5183; Antisense; AGGACATTGTCGTGCCAGTGGCCGA

Paste this into a BLAST search page for me
CACCCGCGGCGGACTGGAAATGTTGGGCGTGTTCTCGGTGATCTGCATCTGATCTGCATCTTCACGGAGAACGACACGACGAGTACGTGGCTTATTACCAGCTTATTACCATAGCGGCCGCAAGAAAGACCATACGCGTATTTCGCACCGTTCGCACCGCGGACACTGAAATGATATGATAGCCAACTACCGGCTGCAGGGCAGGCTGAGCTTACGGCGATCAAAATGGACGCGCTATAGTTTTGGGAACTATGTCGGTGCTGGCGATCGTCGATGAATGAGTACCTGAACGACCTGCCCGGTTGGTTTCAAGGCGGCAATTCGTAGGACATTGTCGTGCCAGTGGCCGA

Full Affymetrix probeset data:

Annotations for 1627074_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime