FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627075_at:

>probe:Drosophila_2:1627075_at:558:483; Interrogation_Position=1028; Antisense; GTATCACGGACTTTGCATTATTCTG
>probe:Drosophila_2:1627075_at:219:127; Interrogation_Position=1076; Antisense; ACCATTGCGGCTTGTTTTACGTGAA
>probe:Drosophila_2:1627075_at:585:63; Interrogation_Position=1108; Antisense; ATGGGTTTTCGCATGGCCATCACCA
>probe:Drosophila_2:1627075_at:662:581; Interrogation_Position=599; Antisense; TGGCCGTGGTCTTTGTCTACCGATA
>probe:Drosophila_2:1627075_at:83:83; Interrogation_Position=640; Antisense; AGGGAGCTTCTCAAACTAGTTAACA
>probe:Drosophila_2:1627075_at:468:439; Interrogation_Position=699; Antisense; GATGGACCTTTTGCTCTATCTGTAC
>probe:Drosophila_2:1627075_at:266:601; Interrogation_Position=719; Antisense; TGTACCATCGCCTATTGGATCTCGG
>probe:Drosophila_2:1627075_at:670:121; Interrogation_Position=746; Antisense; AGCGTCTGGCATCCATCTATGATTA
>probe:Drosophila_2:1627075_at:511:607; Interrogation_Position=785; Antisense; TGATGGTCAGCTTTCTTATCGCCAA
>probe:Drosophila_2:1627075_at:387:705; Interrogation_Position=800; Antisense; TTATCGCCAACGTGCTGGGCATCTA
>probe:Drosophila_2:1627075_at:134:525; Interrogation_Position=816; Antisense; GGGCATCTACTTCTTCATAATCTAC
>probe:Drosophila_2:1627075_at:299:183; Interrogation_Position=871; Antisense; AAAATCCTGGTCTTCGTTCAAGCGC
>probe:Drosophila_2:1627075_at:573:323; Interrogation_Position=892; Antisense; GCGCTGGTCATTAACATGCTGGATT
>probe:Drosophila_2:1627075_at:372:529; Interrogation_Position=958; Antisense; GGGAGACAAACTTCCACCATACTTA

Paste this into a BLAST search page for me
GTATCACGGACTTTGCATTATTCTGACCATTGCGGCTTGTTTTACGTGAAATGGGTTTTCGCATGGCCATCACCATGGCCGTGGTCTTTGTCTACCGATAAGGGAGCTTCTCAAACTAGTTAACAGATGGACCTTTTGCTCTATCTGTACTGTACCATCGCCTATTGGATCTCGGAGCGTCTGGCATCCATCTATGATTATGATGGTCAGCTTTCTTATCGCCAATTATCGCCAACGTGCTGGGCATCTAGGGCATCTACTTCTTCATAATCTACAAAATCCTGGTCTTCGTTCAAGCGCGCGCTGGTCATTAACATGCTGGATTGGGAGACAAACTTCCACCATACTTA

Full Affymetrix probeset data:

Annotations for 1627075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720