FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627076_at:

>probe:Drosophila_2:1627076_at:581:663; Interrogation_Position=495; Antisense; TAAAGGACGCAGCACTTGGGACCGC
>probe:Drosophila_2:1627076_at:688:149; Interrogation_Position=508; Antisense; ACTTGGGACCGCATTCAGCGCAAAG
>probe:Drosophila_2:1627076_at:664:383; Interrogation_Position=544; Antisense; GAACTTTAACTGCAGTCGCCAGACG
>probe:Drosophila_2:1627076_at:441:353; Interrogation_Position=569; Antisense; GCAGCTGCTCTCCAAAGTGTCATAA
>probe:Drosophila_2:1627076_at:624:515; Interrogation_Position=585; Antisense; GTGTCATAATTGTCACCGCCAGGTG
>probe:Drosophila_2:1627076_at:547:409; Interrogation_Position=708; Antisense; GACGACATCATGTGGCTGACATTAG
>probe:Drosophila_2:1627076_at:649:713; Interrogation_Position=741; Antisense; TTCTTTTGTGTGTGCAGCTGCCAAC
>probe:Drosophila_2:1627076_at:525:159; Interrogation_Position=764; Antisense; ACAACAGTTTGCAGCTTGCGTGGCT
>probe:Drosophila_2:1627076_at:551:153; Interrogation_Position=803; Antisense; ACATGTCACGAATCTACTCGCAGTT
>probe:Drosophila_2:1627076_at:90:183; Interrogation_Position=840; Antisense; AAAAGAGTTGGCTTCCTTTGCCTCG
>probe:Drosophila_2:1627076_at:115:641; Interrogation_Position=862; Antisense; TCGGATTGGGCATGTTTATCTCGCT
>probe:Drosophila_2:1627076_at:316:705; Interrogation_Position=877; Antisense; TTATCTCGCTGCTATTTGGCTTCAT
>probe:Drosophila_2:1627076_at:412:431; Interrogation_Position=979; Antisense; GAGTCATGAGTTGGGCGCACTCTCA
>probe:Drosophila_2:1627076_at:212:147; Interrogation_Position=997; Antisense; ACTCTCAAATCCTTCGACTTTCGAA

Paste this into a BLAST search page for me
TAAAGGACGCAGCACTTGGGACCGCACTTGGGACCGCATTCAGCGCAAAGGAACTTTAACTGCAGTCGCCAGACGGCAGCTGCTCTCCAAAGTGTCATAAGTGTCATAATTGTCACCGCCAGGTGGACGACATCATGTGGCTGACATTAGTTCTTTTGTGTGTGCAGCTGCCAACACAACAGTTTGCAGCTTGCGTGGCTACATGTCACGAATCTACTCGCAGTTAAAAGAGTTGGCTTCCTTTGCCTCGTCGGATTGGGCATGTTTATCTCGCTTTATCTCGCTGCTATTTGGCTTCATGAGTCATGAGTTGGGCGCACTCTCAACTCTCAAATCCTTCGACTTTCGAA

Full Affymetrix probeset data:

Annotations for 1627076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720