FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627077_at:

>probe:Drosophila_2:1627077_at:311:57; Interrogation_Position=401; Antisense; ATGAGATGTTCAGTCCGCAGGAGGC
>probe:Drosophila_2:1627077_at:12:71; Interrogation_Position=422; Antisense; AGGCTGCTGCCTACATGAAGTCCAA
>probe:Drosophila_2:1627077_at:221:533; Interrogation_Position=475; Antisense; GGTGATGACCAGTCCTACTTGCAAA
>probe:Drosophila_2:1627077_at:305:721; Interrogation_Position=550; Antisense; TTCCTGTTCACGGACCAGATGGGCA
>probe:Drosophila_2:1627077_at:582:99; Interrogation_Position=566; Antisense; AGATGGGCAGTACTTTCCGCTATCT
>probe:Drosophila_2:1627077_at:592:631; Interrogation_Position=581; Antisense; TCCGCTATCTGAATGTGGTGCCGCA
>probe:Drosophila_2:1627077_at:41:519; Interrogation_Position=595; Antisense; GTGGTGCCGCAATTCAAGTCAATTA
>probe:Drosophila_2:1627077_at:122:441; Interrogation_Position=647; Antisense; GATGGGTGCGCAGTCAGATCCCGAA
>probe:Drosophila_2:1627077_at:477:371; Interrogation_Position=669; Antisense; GAAGTCGTCCTATTTCCGGGTCAAG
>probe:Drosophila_2:1627077_at:109:631; Interrogation_Position=694; Antisense; TCCGGCGGAATTGGCATCTTGACAT
>probe:Drosophila_2:1627077_at:52:539; Interrogation_Position=774; Antisense; GGTTCCCGAGTGGACCTACAAAGCG
>probe:Drosophila_2:1627077_at:430:565; Interrogation_Position=814; Antisense; GGCAATGGGCTGTACGTATTCCTCA
>probe:Drosophila_2:1627077_at:621:473; Interrogation_Position=887; Antisense; GTTACCCAGTTAATTGTCCCATTCA
>probe:Drosophila_2:1627077_at:104:383; Interrogation_Position=927; Antisense; GAACGATGGCTACACCTTCTGTTGC

Paste this into a BLAST search page for me
ATGAGATGTTCAGTCCGCAGGAGGCAGGCTGCTGCCTACATGAAGTCCAAGGTGATGACCAGTCCTACTTGCAAATTCCTGTTCACGGACCAGATGGGCAAGATGGGCAGTACTTTCCGCTATCTTCCGCTATCTGAATGTGGTGCCGCAGTGGTGCCGCAATTCAAGTCAATTAGATGGGTGCGCAGTCAGATCCCGAAGAAGTCGTCCTATTTCCGGGTCAAGTCCGGCGGAATTGGCATCTTGACATGGTTCCCGAGTGGACCTACAAAGCGGGCAATGGGCTGTACGTATTCCTCAGTTACCCAGTTAATTGTCCCATTCAGAACGATGGCTACACCTTCTGTTGC

Full Affymetrix probeset data:

Annotations for 1627077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720