Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627078_at:

>probe:Drosophila_2:1627078_at:206:577; Interrogation_Position=2475; Antisense; GGCGCATGTCCCGTAAATTGTTGGA
>probe:Drosophila_2:1627078_at:716:317; Interrogation_Position=2520; Antisense; GCCGTGATGTGTTGCCTGAAGTTCG
>probe:Drosophila_2:1627078_at:313:567; Interrogation_Position=2556; Antisense; GGCAGAGCCTCGAACTTCCTGGTTT
>probe:Drosophila_2:1627078_at:491:369; Interrogation_Position=2629; Antisense; GAATGACTCTGTGCTCGATGCTGGC
>probe:Drosophila_2:1627078_at:394:581; Interrogation_Position=2650; Antisense; TGGCCTTTATTCCTAGTCCTATATT
>probe:Drosophila_2:1627078_at:24:1; Interrogation_Position=2670; Antisense; ATATTCTTTGGCTGGGTTTTCGATA
>probe:Drosophila_2:1627078_at:151:221; Interrogation_Position=2730; Antisense; AAGGGAAACTGCTGGCTCTACGATC
>probe:Drosophila_2:1627078_at:177:671; Interrogation_Position=2748; Antisense; TACGATCCGCTTTCCATGAGGTACA
>probe:Drosophila_2:1627078_at:565:57; Interrogation_Position=2763; Antisense; ATGAGGTACACTCTCAACTTCACCG
>probe:Drosophila_2:1627078_at:56:133; Interrogation_Position=2784; Antisense; ACCGCAGCTGTCTTTATTGCCATTG
>probe:Drosophila_2:1627078_at:544:627; Interrogation_Position=2801; Antisense; TGCCATTGGAGCCATTTTCGATCTG
>probe:Drosophila_2:1627078_at:234:531; Interrogation_Position=2827; Antisense; GGGTCTGGTACTACGCAAAGGATCT
>probe:Drosophila_2:1627078_at:298:431; Interrogation_Position=2981; Antisense; GAGTCTTGGTGCCTTGATTTGTCAA
>probe:Drosophila_2:1627078_at:193:513; Interrogation_Position=3015; Antisense; GTGATTTCCAACGTAGAGTCCAGTA

Paste this into a BLAST search page for me
GGCGCATGTCCCGTAAATTGTTGGAGCCGTGATGTGTTGCCTGAAGTTCGGGCAGAGCCTCGAACTTCCTGGTTTGAATGACTCTGTGCTCGATGCTGGCTGGCCTTTATTCCTAGTCCTATATTATATTCTTTGGCTGGGTTTTCGATAAAGGGAAACTGCTGGCTCTACGATCTACGATCCGCTTTCCATGAGGTACAATGAGGTACACTCTCAACTTCACCGACCGCAGCTGTCTTTATTGCCATTGTGCCATTGGAGCCATTTTCGATCTGGGGTCTGGTACTACGCAAAGGATCTGAGTCTTGGTGCCTTGATTTGTCAAGTGATTTCCAACGTAGAGTCCAGTA

Full Affymetrix probeset data:

Annotations for 1627078_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime