FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627081_at:

>probe:Drosophila_2:1627081_at:351:507; Interrogation_Position=106; Antisense; GTGCGGACCAATTTGCCAGCGAATG
>probe:Drosophila_2:1627081_at:515:369; Interrogation_Position=126; Antisense; GAATGTGGCCCGCATATACGCCGAT
>probe:Drosophila_2:1627081_at:92:29; Interrogation_Position=141; Antisense; ATACGCCGATCGGATGAGGCCACTG
>probe:Drosophila_2:1627081_at:62:439; Interrogation_Position=156; Antisense; GAGGCCACTGGTGATTCTGGCCCGA
>probe:Drosophila_2:1627081_at:675:715; Interrogation_Position=170; Antisense; TTCTGGCCCGATCCATGGTGCAGGA
>probe:Drosophila_2:1627081_at:89:121; Interrogation_Position=212; Antisense; AGCTGAGTTACGTGCGGCTGCGCAC
>probe:Drosophila_2:1627081_at:457:185; Interrogation_Position=22; Antisense; AACACTGTGCAGATGACCTTCGATC
>probe:Drosophila_2:1627081_at:219:383; Interrogation_Position=267; Antisense; GAACGAGCACACGATCATTCTGATC
>probe:Drosophila_2:1627081_at:8:75; Interrogation_Position=293; Antisense; AGGACAACCGTGTGCTCGACGAATC
>probe:Drosophila_2:1627081_at:612:291; Interrogation_Position=301; Antisense; CGTGTGCTCGACGAATCCTGGAGGA
>probe:Drosophila_2:1627081_at:405:115; Interrogation_Position=325; Antisense; AGCAGTGTCGCCTCGCGGAGAGCCT
>probe:Drosophila_2:1627081_at:235:55; Interrogation_Position=34; Antisense; ATGACCTTCGATCGGCTGGTTCAGC
>probe:Drosophila_2:1627081_at:242:525; Interrogation_Position=74; Antisense; GGGCAATCCTGATCGATGGCAATGG
>probe:Drosophila_2:1627081_at:66:227; Interrogation_Position=94; Antisense; AATGGAGTTCCGGTGCGGACCAATT

Paste this into a BLAST search page for me
GTGCGGACCAATTTGCCAGCGAATGGAATGTGGCCCGCATATACGCCGATATACGCCGATCGGATGAGGCCACTGGAGGCCACTGGTGATTCTGGCCCGATTCTGGCCCGATCCATGGTGCAGGAAGCTGAGTTACGTGCGGCTGCGCACAACACTGTGCAGATGACCTTCGATCGAACGAGCACACGATCATTCTGATCAGGACAACCGTGTGCTCGACGAATCCGTGTGCTCGACGAATCCTGGAGGAAGCAGTGTCGCCTCGCGGAGAGCCTATGACCTTCGATCGGCTGGTTCAGCGGGCAATCCTGATCGATGGCAATGGAATGGAGTTCCGGTGCGGACCAATT

Full Affymetrix probeset data:

Annotations for 1627081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720