FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627082_at:

>probe:Drosophila_2:1627082_at:570:553; Interrogation_Position=1030; Antisense; GGAGCTACCAGTGAGCCAGATATTT
>probe:Drosophila_2:1627082_at:39:661; Interrogation_Position=1076; Antisense; TAACCAGGATTCATCACATCGCCAT
>probe:Drosophila_2:1627082_at:587:261; Interrogation_Position=1113; Antisense; CACCGGACAGGAGCATCATCATCAT
>probe:Drosophila_2:1627082_at:385:37; Interrogation_Position=1139; Antisense; ATCATCACCATCTCAGCATTTCGGG
>probe:Drosophila_2:1627082_at:544:339; Interrogation_Position=1154; Antisense; GCATTTCGGGACAGGCAACGTCGTT
>probe:Drosophila_2:1627082_at:242:247; Interrogation_Position=1186; Antisense; AATTCTCACGCAGACTTCAGGGAAA
>probe:Drosophila_2:1627082_at:724:163; Interrogation_Position=1208; Antisense; AAATCGAGTGCGAGCGACTGCGACG
>probe:Drosophila_2:1627082_at:417:659; Interrogation_Position=1248; Antisense; TAAGCGCATCTATAGCATATCGGAA
>probe:Drosophila_2:1627082_at:621:541; Interrogation_Position=711; Antisense; GGTTGTGCCACCACTGCAATTGCAA
>probe:Drosophila_2:1627082_at:491:647; Interrogation_Position=739; Antisense; TCATCACCGCTATTTGTGGAGCTTA
>probe:Drosophila_2:1627082_at:405:33; Interrogation_Position=822; Antisense; ATCAATCGAAGAGCCACAGTGCCCT
>probe:Drosophila_2:1627082_at:206:687; Interrogation_Position=871; Antisense; TATTTGGCCGAGACTTTGGACGATC
>probe:Drosophila_2:1627082_at:675:727; Interrogation_Position=886; Antisense; TTGGACGATCTTGCCGAATCCGAAG
>probe:Drosophila_2:1627082_at:305:97; Interrogation_Position=909; Antisense; AGATCAGCGGTATTCGCCAGCCGAA

Paste this into a BLAST search page for me
GGAGCTACCAGTGAGCCAGATATTTTAACCAGGATTCATCACATCGCCATCACCGGACAGGAGCATCATCATCATATCATCACCATCTCAGCATTTCGGGGCATTTCGGGACAGGCAACGTCGTTAATTCTCACGCAGACTTCAGGGAAAAAATCGAGTGCGAGCGACTGCGACGTAAGCGCATCTATAGCATATCGGAAGGTTGTGCCACCACTGCAATTGCAATCATCACCGCTATTTGTGGAGCTTAATCAATCGAAGAGCCACAGTGCCCTTATTTGGCCGAGACTTTGGACGATCTTGGACGATCTTGCCGAATCCGAAGAGATCAGCGGTATTCGCCAGCCGAA

Full Affymetrix probeset data:

Annotations for 1627082_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720