Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627085_a_at:

>probe:Drosophila_2:1627085_a_at:201:37; Interrogation_Position=106; Antisense; ATCTATCCCATTGCAGGTCCTTGTC
>probe:Drosophila_2:1627085_a_at:326:723; Interrogation_Position=116; Antisense; TTGCAGGTCCTTGTCCAGCCTCGTA
>probe:Drosophila_2:1627085_a_at:563:123; Interrogation_Position=132; Antisense; AGCCTCGTACTTCACATGCAACGAT
>probe:Drosophila_2:1627085_a_at:382:149; Interrogation_Position=140; Antisense; ACTTCACATGCAACGATGGCTTCTG
>probe:Drosophila_2:1627085_a_at:295:441; Interrogation_Position=154; Antisense; GATGGCTTCTGCATACCGATGCGAT
>probe:Drosophila_2:1627085_a_at:11:673; Interrogation_Position=167; Antisense; TACCGATGCGATGGAAATGCGATTC
>probe:Drosophila_2:1627085_a_at:678:233; Interrogation_Position=182; Antisense; AATGCGATTCCAAGGCCGATTGTCC
>probe:Drosophila_2:1627085_a_at:704:141; Interrogation_Position=19; Antisense; ACTGTGGCCGAGACTCAAATGATTG
>probe:Drosophila_2:1627085_a_at:408:227; Interrogation_Position=193; Antisense; AAGGCCGATTGTCCGGACATGTCCG
>probe:Drosophila_2:1627085_a_at:98:605; Interrogation_Position=38; Antisense; TGATTGAATGGCTGGCTGCCTGCAC
>probe:Drosophila_2:1627085_a_at:367:615; Interrogation_Position=58; Antisense; TGCACTTCCTCGTTCTTCCTTTGCA
>probe:Drosophila_2:1627085_a_at:119:721; Interrogation_Position=73; Antisense; TTCCTTTGCATCCTGAGTGACCATT
>probe:Drosophila_2:1627085_a_at:683:345; Interrogation_Position=80; Antisense; GCATCCTGAGTGACCATTATTCCGT
>probe:Drosophila_2:1627085_a_at:601:15; Interrogation_Position=95; Antisense; ATTATTCCGTCATCTATCCCATTGC

Paste this into a BLAST search page for me
ATCTATCCCATTGCAGGTCCTTGTCTTGCAGGTCCTTGTCCAGCCTCGTAAGCCTCGTACTTCACATGCAACGATACTTCACATGCAACGATGGCTTCTGGATGGCTTCTGCATACCGATGCGATTACCGATGCGATGGAAATGCGATTCAATGCGATTCCAAGGCCGATTGTCCACTGTGGCCGAGACTCAAATGATTGAAGGCCGATTGTCCGGACATGTCCGTGATTGAATGGCTGGCTGCCTGCACTGCACTTCCTCGTTCTTCCTTTGCATTCCTTTGCATCCTGAGTGACCATTGCATCCTGAGTGACCATTATTCCGTATTATTCCGTCATCTATCCCATTGC

Full Affymetrix probeset data:

Annotations for 1627085_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime