FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627086_at:

>probe:Drosophila_2:1627086_at:687:311; Interrogation_Position=130; Antisense; GCCAGCGCATGTGGCACAAAGCACT
>probe:Drosophila_2:1627086_at:182:113; Interrogation_Position=149; Antisense; AGCACTTTCGCACATGCTGCTTTAA
>probe:Drosophila_2:1627086_at:132:49; Interrogation_Position=162; Antisense; ATGCTGCTTTAACTACCTTCGCAAG
>probe:Drosophila_2:1627086_at:481:49; Interrogation_Position=200; Antisense; ATGCACTGCGTCAGAGCTCGAACAG
>probe:Drosophila_2:1627086_at:176:587; Interrogation_Position=21; Antisense; TGGAGTCCTCGTCCTGGCTATTCAT
>probe:Drosophila_2:1627086_at:229:189; Interrogation_Position=220; Antisense; AACAGGAGGCTCATCGACTTCATAC
>probe:Drosophila_2:1627086_at:548:647; Interrogation_Position=230; Antisense; TCATCGACTTCATACTGCTGCAGGG
>probe:Drosophila_2:1627086_at:376:281; Interrogation_Position=262; Antisense; CTCTTCACCCAGGAGTTGCGAGAAA
>probe:Drosophila_2:1627086_at:129:395; Interrogation_Position=283; Antisense; GAAAGGCGCCACAATGGCACATTGA
>probe:Drosophila_2:1627086_at:380:151; Interrogation_Position=301; Antisense; ACATTGATGGACCTCGGCCTGAACA
>probe:Drosophila_2:1627086_at:412:257; Interrogation_Position=50; Antisense; CACACGCTTCATTGACCACTTTGAA
>probe:Drosophila_2:1627086_at:394:725; Interrogation_Position=61; Antisense; TTGACCACTTTGAATGCCAGCATCT
>probe:Drosophila_2:1627086_at:254:369; Interrogation_Position=72; Antisense; GAATGCCAGCATCTCAAATTCGCAG
>probe:Drosophila_2:1627086_at:22:69; Interrogation_Position=95; Antisense; AGGCCATAAAATGCGACACTTGTGG

Paste this into a BLAST search page for me
GCCAGCGCATGTGGCACAAAGCACTAGCACTTTCGCACATGCTGCTTTAAATGCTGCTTTAACTACCTTCGCAAGATGCACTGCGTCAGAGCTCGAACAGTGGAGTCCTCGTCCTGGCTATTCATAACAGGAGGCTCATCGACTTCATACTCATCGACTTCATACTGCTGCAGGGCTCTTCACCCAGGAGTTGCGAGAAAGAAAGGCGCCACAATGGCACATTGAACATTGATGGACCTCGGCCTGAACACACACGCTTCATTGACCACTTTGAATTGACCACTTTGAATGCCAGCATCTGAATGCCAGCATCTCAAATTCGCAGAGGCCATAAAATGCGACACTTGTGG

Full Affymetrix probeset data:

Annotations for 1627086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720